ID: 1095826822

View in Genome Browser
Species Human (GRCh38)
Location 12:46538501-46538523
Sequence CCATTTTATCACATCTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095826820_1095826822 11 Left 1095826820 12:46538467-46538489 CCTCAAGATTACAATACACTGTG No data
Right 1095826822 12:46538501-46538523 CCATTTTATCACATCTATATTGG No data
1095826819_1095826822 17 Left 1095826819 12:46538461-46538483 CCTTAGCCTCAAGATTACAATAC No data
Right 1095826822 12:46538501-46538523 CCATTTTATCACATCTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095826822 Original CRISPR CCATTTTATCACATCTATAT TGG Intergenic
No off target data available for this crispr