ID: 1095833234

View in Genome Browser
Species Human (GRCh38)
Location 12:46609810-46609832
Sequence ACTAGCCATCTCTATGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095833230_1095833234 -3 Left 1095833230 12:46609790-46609812 CCAGACAGCCTGCTTTGGCCACT No data
Right 1095833234 12:46609810-46609832 ACTAGCCATCTCTATGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095833234 Original CRISPR ACTAGCCATCTCTATGGCCT TGG Intergenic
No off target data available for this crispr