ID: 1095833549

View in Genome Browser
Species Human (GRCh38)
Location 12:46613063-46613085
Sequence CAGGGTTAGTAGAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095833549_1095833557 17 Left 1095833549 12:46613063-46613085 CCATGTTCCCTCTACTAACCCTG No data
Right 1095833557 12:46613103-46613125 CCAAATCTCAGTGAACATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095833549 Original CRISPR CAGGGTTAGTAGAGGGAACA TGG (reversed) Intergenic
No off target data available for this crispr