ID: 1095835804

View in Genome Browser
Species Human (GRCh38)
Location 12:46637752-46637774
Sequence TGTTAGCCAGAGAACACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095835804_1095835812 19 Left 1095835804 12:46637752-46637774 CCACCAGTGTTCTCTGGCTAACA No data
Right 1095835812 12:46637794-46637816 GCATGGAGCTCCCAGAAGTAGGG No data
1095835804_1095835813 20 Left 1095835804 12:46637752-46637774 CCACCAGTGTTCTCTGGCTAACA No data
Right 1095835813 12:46637795-46637817 CATGGAGCTCCCAGAAGTAGGGG No data
1095835804_1095835811 18 Left 1095835804 12:46637752-46637774 CCACCAGTGTTCTCTGGCTAACA No data
Right 1095835811 12:46637793-46637815 GGCATGGAGCTCCCAGAAGTAGG No data
1095835804_1095835807 2 Left 1095835804 12:46637752-46637774 CCACCAGTGTTCTCTGGCTAACA No data
Right 1095835807 12:46637777-46637799 GCTTTCTAACCTCCCTGGCATGG No data
1095835804_1095835806 -3 Left 1095835804 12:46637752-46637774 CCACCAGTGTTCTCTGGCTAACA No data
Right 1095835806 12:46637772-46637794 ACAGAGCTTTCTAACCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095835804 Original CRISPR TGTTAGCCAGAGAACACTGG TGG (reversed) Intergenic
No off target data available for this crispr