ID: 1095835979

View in Genome Browser
Species Human (GRCh38)
Location 12:46638765-46638787
Sequence TGCCTCTCCCCCTTTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095835979_1095835983 3 Left 1095835979 12:46638765-46638787 CCAGAACTAAAGGGGGAGAGGCA No data
Right 1095835983 12:46638791-46638813 ACACTTTCAGAGCATTGAGAGGG No data
1095835979_1095835982 2 Left 1095835979 12:46638765-46638787 CCAGAACTAAAGGGGGAGAGGCA No data
Right 1095835982 12:46638790-46638812 CACACTTTCAGAGCATTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095835979 Original CRISPR TGCCTCTCCCCCTTTAGTTC TGG (reversed) Intergenic
No off target data available for this crispr