ID: 1095837675

View in Genome Browser
Species Human (GRCh38)
Location 12:46655983-46656005
Sequence GTAGCATCCCACATATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095837668_1095837675 12 Left 1095837668 12:46655948-46655970 CCCAATTTTTCCCAATTTGGTTT No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data
1095837667_1095837675 13 Left 1095837667 12:46655947-46655969 CCCCAATTTTTCCCAATTTGGTT No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data
1095837665_1095837675 17 Left 1095837665 12:46655943-46655965 CCTTCCCCAATTTTTCCCAATTT No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data
1095837670_1095837675 2 Left 1095837670 12:46655958-46655980 CCCAATTTGGTTTATACAGCTAT No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data
1095837671_1095837675 1 Left 1095837671 12:46655959-46655981 CCAATTTGGTTTATACAGCTATG No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data
1095837669_1095837675 11 Left 1095837669 12:46655949-46655971 CCAATTTTTCCCAATTTGGTTTA No data
Right 1095837675 12:46655983-46656005 GTAGCATCCCACATATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095837675 Original CRISPR GTAGCATCCCACATATTTGG GGG Intergenic
No off target data available for this crispr