ID: 1095843098

View in Genome Browser
Species Human (GRCh38)
Location 12:46715876-46715898
Sequence TTTTAGGTATAAAACTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095843098_1095843100 6 Left 1095843098 12:46715876-46715898 CCAAACAAGTTTTATACCTAAAA No data
Right 1095843100 12:46715905-46715927 TCTTGAAAGAACAAAGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095843098 Original CRISPR TTTTAGGTATAAAACTTGTT TGG (reversed) Intergenic
No off target data available for this crispr