ID: 1095844394

View in Genome Browser
Species Human (GRCh38)
Location 12:46729957-46729979
Sequence AACAGCTCTTGGCCTGTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095844394_1095844400 -9 Left 1095844394 12:46729957-46729979 CCATTAACAGGCCAAGAGCTGTT No data
Right 1095844400 12:46729971-46729993 AGAGCTGTTGCTCAAAAGGGGGG No data
1095844394_1095844401 11 Left 1095844394 12:46729957-46729979 CCATTAACAGGCCAAGAGCTGTT No data
Right 1095844401 12:46729991-46730013 GGGTAGTTATCTGCAGAAGATGG No data
1095844394_1095844403 16 Left 1095844394 12:46729957-46729979 CCATTAACAGGCCAAGAGCTGTT No data
Right 1095844403 12:46729996-46730018 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
1095844394_1095844402 15 Left 1095844394 12:46729957-46729979 CCATTAACAGGCCAAGAGCTGTT No data
Right 1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
1095844394_1095844399 -10 Left 1095844394 12:46729957-46729979 CCATTAACAGGCCAAGAGCTGTT No data
Right 1095844399 12:46729970-46729992 AAGAGCTGTTGCTCAAAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095844394 Original CRISPR AACAGCTCTTGGCCTGTTAA TGG (reversed) Intergenic
No off target data available for this crispr