ID: 1095847363

View in Genome Browser
Species Human (GRCh38)
Location 12:46760023-46760045
Sequence CTTTATTAGTAGTGTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7258
Summary {0: 2, 1: 154, 2: 1433, 3: 1997, 4: 3672}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095847355_1095847363 22 Left 1095847355 12:46759978-46760000 CCACTAAACCTCTTCCTTTTGTA 0: 1
1: 70
2: 1351
3: 1470
4: 1942
Right 1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG 0: 2
1: 154
2: 1433
3: 1997
4: 3672
1095847356_1095847363 14 Left 1095847356 12:46759986-46760008 CCTCTTCCTTTTGTAAATTGCCC 0: 48
1: 1661
2: 1811
3: 1734
4: 5738
Right 1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG 0: 2
1: 154
2: 1433
3: 1997
4: 3672
1095847359_1095847363 -6 Left 1095847359 12:46760006-46760028 CCCAGTCCCTGGTATGTCTTTAT 0: 5
1: 292
2: 4547
3: 9062
4: 11102
Right 1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG 0: 2
1: 154
2: 1433
3: 1997
4: 3672
1095847357_1095847363 8 Left 1095847357 12:46759992-46760014 CCTTTTGTAAATTGCCCAGTCCC 0: 2
1: 35
2: 72
3: 186
4: 344
Right 1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG 0: 2
1: 154
2: 1433
3: 1997
4: 3672
1095847360_1095847363 -7 Left 1095847360 12:46760007-46760029 CCAGTCCCTGGTATGTCTTTATT 0: 2
1: 127
2: 1919
3: 5902
4: 9224
Right 1095847363 12:46760023-46760045 CTTTATTAGTAGTGTGAAAAAGG 0: 2
1: 154
2: 1433
3: 1997
4: 3672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095847363 Original CRISPR CTTTATTAGTAGTGTGAAAA AGG Intergenic
Too many off-targets to display for this crispr