ID: 1095853943

View in Genome Browser
Species Human (GRCh38)
Location 12:46840444-46840466
Sequence CTAGCTCATACCTTTAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095853943_1095853945 4 Left 1095853943 12:46840444-46840466 CCCTTTTTAAAGGTATGAGCTAG No data
Right 1095853945 12:46840471-46840493 TGAGTTTGTCTAGATGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095853943 Original CRISPR CTAGCTCATACCTTTAAAAA GGG (reversed) Intergenic
No off target data available for this crispr