ID: 1095864622

View in Genome Browser
Species Human (GRCh38)
Location 12:46957885-46957907
Sequence GAGCCTGTCCACTGCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095864622_1095864625 17 Left 1095864622 12:46957885-46957907 CCTGGAAAGCAGTGGACAGGCTC No data
Right 1095864625 12:46957925-46957947 TTCGTGAGGACCTCTCTGGATGG No data
1095864622_1095864624 13 Left 1095864622 12:46957885-46957907 CCTGGAAAGCAGTGGACAGGCTC No data
Right 1095864624 12:46957921-46957943 TCTCTTCGTGAGGACCTCTCTGG No data
1095864622_1095864623 3 Left 1095864622 12:46957885-46957907 CCTGGAAAGCAGTGGACAGGCTC No data
Right 1095864623 12:46957911-46957933 GAGAAAAACATCTCTTCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095864622 Original CRISPR GAGCCTGTCCACTGCTTTCC AGG (reversed) Intergenic