ID: 1095866931

View in Genome Browser
Species Human (GRCh38)
Location 12:46982868-46982890
Sequence TTCATCCCAAGTTAGCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095866931_1095866935 -4 Left 1095866931 12:46982868-46982890 CCCTGGAGCTAACTTGGGATGAA No data
Right 1095866935 12:46982887-46982909 TGAAGATGGAGATGTTGTGAGGG No data
1095866931_1095866937 8 Left 1095866931 12:46982868-46982890 CCCTGGAGCTAACTTGGGATGAA No data
Right 1095866937 12:46982899-46982921 TGTTGTGAGGGAAAGACACTGGG No data
1095866931_1095866936 7 Left 1095866931 12:46982868-46982890 CCCTGGAGCTAACTTGGGATGAA No data
Right 1095866936 12:46982898-46982920 ATGTTGTGAGGGAAAGACACTGG No data
1095866931_1095866934 -5 Left 1095866931 12:46982868-46982890 CCCTGGAGCTAACTTGGGATGAA No data
Right 1095866934 12:46982886-46982908 ATGAAGATGGAGATGTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095866931 Original CRISPR TTCATCCCAAGTTAGCTCCA GGG (reversed) Intergenic
No off target data available for this crispr