ID: 1095871175

View in Genome Browser
Species Human (GRCh38)
Location 12:47029927-47029949
Sequence CCACATGGTTAGTTTCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095871170_1095871175 26 Left 1095871170 12:47029878-47029900 CCTTATGATGACGACTATAAGTC No data
Right 1095871175 12:47029927-47029949 CCACATGGTTAGTTTCTTCATGG No data
1095871172_1095871175 -5 Left 1095871172 12:47029909-47029931 CCGACACATTCTACTTCACCACA No data
Right 1095871175 12:47029927-47029949 CCACATGGTTAGTTTCTTCATGG No data
1095871171_1095871175 4 Left 1095871171 12:47029900-47029922 CCTCAAAGTCCGACACATTCTAC No data
Right 1095871175 12:47029927-47029949 CCACATGGTTAGTTTCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095871175 Original CRISPR CCACATGGTTAGTTTCTTCA TGG Intergenic
No off target data available for this crispr