ID: 1095871505

View in Genome Browser
Species Human (GRCh38)
Location 12:47033346-47033368
Sequence CACCTATTGTAACTGGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095871499_1095871505 30 Left 1095871499 12:47033293-47033315 CCGCTCTGCAGGGACAAGGACTG No data
Right 1095871505 12:47033346-47033368 CACCTATTGTAACTGGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095871505 Original CRISPR CACCTATTGTAACTGGTCAT TGG Intergenic
No off target data available for this crispr