ID: 1095876159

View in Genome Browser
Species Human (GRCh38)
Location 12:47080919-47080941
Sequence AGTAAGGGGCGTGTGCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095876146_1095876159 24 Left 1095876146 12:47080872-47080894 CCTCCCCGTCTTTTGCAAGCGTG 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1095876144_1095876159 30 Left 1095876144 12:47080866-47080888 CCGCCACCTCCCCGTCTTTTGCA 0: 1
1: 0
2: 4
3: 36
4: 460
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1095876148_1095876159 20 Left 1095876148 12:47080876-47080898 CCCGTCTTTTGCAAGCGTGCTCG 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1095876149_1095876159 19 Left 1095876149 12:47080877-47080899 CCGTCTTTTGCAAGCGTGCTCGT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1095876145_1095876159 27 Left 1095876145 12:47080869-47080891 CCACCTCCCCGTCTTTTGCAAGC 0: 1
1: 0
2: 0
3: 8
4: 200
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99
1095876147_1095876159 21 Left 1095876147 12:47080875-47080897 CCCCGTCTTTTGCAAGCGTGCTC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095876159 Original CRISPR AGTAAGGGGCGTGTGCGCGG AGG Intronic
903293811 1:22331196-22331218 AGAAAGGGGCCTGGGCGCAGTGG + Intergenic
904586942 1:31585876-31585898 GGTGAGGGGCGTGTGGGCAGAGG + Exonic
905764648 1:40590385-40590407 AGTGAGGGGGCTGGGCGCGGTGG - Intergenic
914433397 1:147639905-147639927 AGTAAAGGGAGTGTGCCGGGAGG - Intronic
921603979 1:217135512-217135534 AGCAAGGGGCGCGCGCGCGGCGG + Intronic
922951064 1:229558732-229558754 AGCAAAGGGCGTGGACGCGGTGG + Intergenic
923731611 1:236556580-236556602 AGAAAGGGGCCTGTGCTCTGAGG - Intronic
1067293265 10:44959641-44959663 AGTGAGGGGCGTGCTCGGGGCGG + Intronic
1068266375 10:54655405-54655427 GGTAAGGGGTGTGTGTGTGGTGG + Intronic
1069616747 10:69811179-69811201 AGGAAGGAGCGTGTGGGCAGAGG - Intronic
1069860463 10:71468076-71468098 AGCAAGGAGCGTGTGGGCTGGGG - Intronic
1073498891 10:103918369-103918391 AGGATGGGGCGTGGCCGCGGCGG - Intergenic
1076284177 10:129277257-129277279 AGTGAAGGGAGTGTGCTCGGTGG + Intergenic
1077360431 11:2138207-2138229 GGTAAGCGGCGTGTGCGGGCCGG - Intronic
1081857442 11:46312670-46312692 AGTAAGGGGCTTGGGAGGGGTGG + Exonic
1083995223 11:66268446-66268468 AGTGATGGGAGTGGGCGCGGAGG + Intergenic
1084257949 11:67955460-67955482 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1084814809 11:71639769-71639791 AGTAAGTGACGCGGGCGCGGGGG + Intergenic
1090002752 11:122976913-122976935 CGTAAGGGGCGTCTGCGCCTGGG + Intergenic
1091182380 11:133618581-133618603 AGGAAGGGGCGTCTGTGCTGAGG - Intergenic
1091558673 12:1594429-1594451 GGCAGGGGGCGTGGGCGCGGCGG - Intronic
1092428180 12:8390248-8390270 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1092429262 12:8396401-8396423 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1093498513 12:19783788-19783810 AGTCCAGGGCGTGTGTGCGGGGG + Intergenic
1095876159 12:47080919-47080941 AGTAAGGGGCGTGTGCGCGGAGG + Intronic
1096647842 12:53047958-53047980 AGAAAGGGGGGTGTGGGTGGAGG + Intronic
1098777215 12:74635400-74635422 AGGAAAGGGCCTGGGCGCGGTGG - Intergenic
1100474149 12:94920207-94920229 AGTAATGGGGCTGGGCGCGGTGG + Intronic
1104892864 12:132148738-132148760 GGTGAGGGGCGGGTGGGCGGGGG - Intronic
1104899071 12:132178515-132178537 TGTAAGGGGAGTGGGGGCGGGGG - Intergenic
1105328853 13:19395573-19395595 AGGAAGGGGCTTGTGCACTGGGG + Intergenic
1106627347 13:31434245-31434267 AGTGAAGGGCGTGTGGGGGGTGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113801029 13:113086318-113086340 AGCGAGGGGCGTGTGCAGGGAGG - Intronic
1117791913 14:59350441-59350463 TGTAAGGGGCGTGTGCATGAGGG - Intronic
1128782980 15:70375188-70375210 CGGGAGGGGCGTGTGCGGGGAGG - Intergenic
1129786421 15:78313146-78313168 AGTGAGGGGCCTGTGCTGGGTGG + Intergenic
1129983546 15:79896708-79896730 ACTAGGGGGCGTGCGCGCGCCGG + Intronic
1132464854 16:72637-72659 AGCGAGGGGCGTGCGCCCGGGGG + Intronic
1133370047 16:5240105-5240127 AGTAAGTGACGCGGGCGCGGGGG + Intergenic
1136631825 16:31493412-31493434 AGTGAGGGGAGTGTGGGTGGCGG + Intronic
1138565360 16:57828804-57828826 GGTGAGGGGCTTGTGCGTGGAGG - Intronic
1142064769 16:88055284-88055306 ATTCAGGGGTGTGTGTGCGGAGG - Intronic
1142882567 17:2893326-2893348 AGTAAGGGGGCTGGGTGCGGTGG - Intronic
1145094185 17:20009928-20009950 AGGAAGGGGCGGGAGCGCGGCGG - Intronic
1147341406 17:39754964-39754986 AGTGAGGGGGGTGTGAGGGGAGG - Intergenic
1147439087 17:40436529-40436551 AGTAAGGGCCCTGTGCGCATGGG + Intergenic
1153811688 18:8757610-8757632 AGGAAGGGGCGTGTGTGCAAGGG + Intronic
1160706119 19:531194-531216 AGGAAGGGGCGGGAGCGAGGCGG - Intergenic
1160921727 19:1523945-1523967 AGTGGGGGGCGCGTGAGCGGCGG - Intergenic
1162128459 19:8511673-8511695 AGGAAGGGGCGCAGGCGCGGGGG + Exonic
1162745181 19:12793886-12793908 CGGAGGGGGCGTGGGCGCGGCGG - Intronic
1163127919 19:15254358-15254380 AGTGAGGAGCCTGTGCACGGTGG + Intronic
1165831628 19:38733493-38733515 GGCAAGGGGCGTGTGTGGGGTGG - Intronic
1167052980 19:47090977-47090999 AGTCAGGGGGCTGGGCGCGGTGG + Intronic
1167251224 19:48399276-48399298 AGGAATGGGCCTGGGCGCGGTGG + Intronic
1168382255 19:55933737-55933759 AGCAAGGGGGCTGGGCGCGGTGG + Intergenic
938025326 2:127942699-127942721 AGTAAAGGGGCTGGGCGCGGTGG + Intronic
1173404796 20:42755102-42755124 AGGAAGGGAGGTGTGGGCGGGGG + Intronic
1175862995 20:62160094-62160116 AGAAATGGGAGTGTGGGCGGTGG + Intronic
1179074982 21:38112738-38112760 AGAAAGGGGGCTGGGCGCGGTGG + Intronic
1179891574 21:44338459-44338481 AGGAAGGGACGTGGGTGCGGTGG - Intronic
1181040486 22:20190146-20190168 AGGAAGGGGGCTGGGCGCGGTGG + Intergenic
1182278734 22:29206182-29206204 AGGTGGGGGCGTGTGCGCGCCGG - Intronic
1185052187 22:48559706-48559728 AGGAAGGGGCGTGTGGGATGAGG + Intronic
950710561 3:14810603-14810625 AGGAGGGGGCGCGAGCGCGGGGG - Intergenic
954916698 3:54154502-54154524 AGTAAGGGGCGTTTGCGGCATGG - Intronic
960851228 3:122056617-122056639 AGTGACGGCCGGGTGCGCGGTGG - Intronic
961281196 3:125766818-125766840 AGTAAGTGACGTTGGCGCGGGGG + Intergenic
961446666 3:126984286-126984308 AGAAAGGGGTGTGTGTGCCGGGG + Intergenic
965876136 3:173322546-173322568 AGTAAGGGGGCTGGGCGCAGTGG - Intergenic
968657114 4:1783460-1783482 AGTAAGGGGTGGGTGGGCAGGGG + Intergenic
969016490 4:4107258-4107280 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
977094650 4:92725011-92725033 AGTTAGGGGGCTGGGCGCGGTGG + Intronic
979462983 4:121004238-121004260 AGTGAGGGGTGTGTGAGCGTGGG - Intergenic
996578753 5:125006458-125006480 AGTAAGGGGTATGTGGGGGGAGG - Intergenic
1003211104 6:4067498-4067520 AGTAAGGTGGCTGTGCGTGGTGG - Intronic
1003879359 6:10466241-10466263 AGCAAAGGGAGTGTGCGCTGGGG - Intergenic
1014009772 6:116462243-116462265 GGTGAGGGGCGCGAGCGCGGCGG - Exonic
1019109977 6:169702043-169702065 CGAAAGGGGCGTGGGCGCGAGGG - Intronic
1019407888 7:893388-893410 AGTGTTGGGCGTGGGCGCGGTGG + Intronic
1021315503 7:19143954-19143976 AGTAAGGGGCGAGTGCACTCGGG - Intergenic
1024965403 7:55019205-55019227 AGTCAGGGGGCCGTGCGCGGTGG - Exonic
1028838055 7:95396448-95396470 AGTAGGAGGCGTGTGCGGGCGGG - Intergenic
1029074954 7:97928060-97928082 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1032389175 7:131544634-131544656 AGTACAGGGCGTGCGTGCGGAGG - Intronic
1033781187 7:144671262-144671284 AGTTAGGGACGTGTGTGGGGAGG + Intronic
1034279675 7:149844333-149844355 AGAAACGGGCGTGTGGGAGGCGG + Intronic
1036242564 8:7092320-7092342 AGTAAGTGACGCGGGCGCGGGGG + Intergenic
1036259287 8:7227831-7227853 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1036311329 8:7686401-7686423 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1036830169 8:12014809-12014831 AGTAAGTGACGCGGGCGCGGAGG - Exonic
1036899251 8:12659108-12659130 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1036900320 8:12665256-12665278 AGTAAGTGACGCGGGCGCGGGGG - Intergenic
1038327134 8:26579643-26579665 GGGAGGGGGCGTGTGCTCGGAGG + Intronic
1049713921 8:144080635-144080657 AGTGAGGGGTGTGTGGGCAGAGG - Exonic
1049773606 8:144394860-144394882 GGTAAGGGGCCAGTGAGCGGGGG - Exonic
1062467421 9:136687418-136687440 AATAAGGGGCCTGAGCGCGCGGG - Exonic
1190775303 X:53547791-53547813 AGTAGGGGGTGTGGGCGTGGTGG + Exonic
1198235936 X:134735988-134736010 AGTAAAGGGGCTGGGCGCGGTGG + Intronic
1199476200 X:148248131-148248153 AGGAAGGGGCATGTGGGGGGAGG - Intergenic
1202603035 Y:26614023-26614045 AGGAAGGGGCTTGTGCACTGGGG - Intergenic