ID: 1095881401

View in Genome Browser
Species Human (GRCh38)
Location 12:47141257-47141279
Sequence ATGGACAAAAGTGCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 3, 1: 12, 2: 17, 3: 36, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095881392_1095881401 22 Left 1095881392 12:47141212-47141234 CCTTGATCATATTTCCCCACAGC 0: 1
1: 0
2: 0
3: 14
4: 184
Right 1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG 0: 3
1: 12
2: 17
3: 36
4: 219
1095881396_1095881401 6 Left 1095881396 12:47141228-47141250 CCACAGCAACAAGAACTTGGTAG 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG 0: 3
1: 12
2: 17
3: 36
4: 219
1095881391_1095881401 23 Left 1095881391 12:47141211-47141233 CCCTTGATCATATTTCCCCACAG 0: 1
1: 0
2: 2
3: 16
4: 185
Right 1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG 0: 3
1: 12
2: 17
3: 36
4: 219
1095881394_1095881401 8 Left 1095881394 12:47141226-47141248 CCCCACAGCAACAAGAACTTGGT 0: 1
1: 0
2: 1
3: 4
4: 137
Right 1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG 0: 3
1: 12
2: 17
3: 36
4: 219
1095881395_1095881401 7 Left 1095881395 12:47141227-47141249 CCCACAGCAACAAGAACTTGGTA 0: 1
1: 0
2: 3
3: 12
4: 142
Right 1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG 0: 3
1: 12
2: 17
3: 36
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095881401 Original CRISPR ATGGACAAAAGTGCCTTTGT GGG Intronic
900848900 1:5126468-5126490 GGGGACTAAACTGCCTTTGTAGG + Intergenic
902081774 1:13825993-13826015 ATGGCCAAATGTTCCATTGTAGG + Intergenic
902912223 1:19608220-19608242 ATGGACAAAAGTGTCATTGAAGG - Intronic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
912057534 1:105623234-105623256 ACAGTCAAAAGTGCCTTTGCAGG - Intergenic
913281533 1:117189837-117189859 GTGGATACCAGTGCCTTTGTGGG + Intronic
915091547 1:153429641-153429663 ATGGAGAGCAGTGCCTTTGATGG + Intergenic
917782331 1:178411665-178411687 ATGGACAAAAGTGTCACTGAAGG - Intronic
918613086 1:186513912-186513934 ATGGTCAAAAGTGTCTCTGCAGG - Intergenic
919305206 1:195823525-195823547 ATGGACTAAAGTGTCATTGTGGG - Intergenic
920530193 1:206696141-206696163 ATGGACAAAAGTGTCATTGAAGG + Intronic
922096138 1:222444622-222444644 TTGGACAAAAGTGTCTGTGGTGG - Intergenic
923892485 1:238231488-238231510 AGGGACAATAATGCATTTGTGGG - Intergenic
924009037 1:239644291-239644313 AGGGACAAAAGTGCAATTGAAGG + Intronic
1065199998 10:23303816-23303838 GTGGACAAAAGTTCCCTTGAGGG + Intronic
1065622736 10:27599932-27599954 ATGGACAAAAGTGCCCTTGTGGG - Intergenic
1066011610 10:31199603-31199625 ATGCACCAATGTGCCTTTTTAGG + Intergenic
1067399836 10:45961249-45961271 ATGGAAAACAGTGCCTTTGCTGG - Intergenic
1067868165 10:49930540-49930562 ATGGAAAACAGTGCCTTTGCTGG - Intronic
1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG + Intronic
1068495932 10:57785653-57785675 AGGAACAAAAATGCCTTTTTTGG - Intergenic
1068583241 10:58766616-58766638 ATGGACAAGAGTACCTTTGTGGG + Intronic
1069059634 10:63882128-63882150 ACAGACAAAAGTACCTTTATGGG - Intergenic
1071045274 10:81366303-81366325 ATTGACAAGAGTACTTTTGTGGG - Intergenic
1071070006 10:81680804-81680826 AGGGACTATATTGCCTTTGTAGG - Intergenic
1071989933 10:91091845-91091867 ATGTACATATGTGCCTTTGTGGG - Intergenic
1072041995 10:91615652-91615674 ATGTACAAGAGTTTCTTTGTAGG + Intergenic
1072298570 10:94037194-94037216 TTTCACAAAAATGCCTTTGTTGG + Intronic
1073806831 10:107107636-107107658 ACAGACAAAATAGCCTTTGTGGG + Intronic
1079553468 11:21730209-21730231 ATCAGTAAAAGTGCCTTTGTGGG - Intergenic
1079613051 11:22456986-22457008 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1081402767 11:42661936-42661958 ACTGACAAACGTGCCTTGGTGGG - Intergenic
1082867498 11:57913178-57913200 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1084350184 11:68591831-68591853 ATGGCCAGAAATGCCCTTGTTGG + Intronic
1086515190 11:87603881-87603903 ACAGATAAAAGTGCCATTGTGGG + Intergenic
1087024213 11:93633865-93633887 AAGGACTAGATTGCCTTTGTAGG - Intergenic
1087132901 11:94684261-94684283 ACGGACAAAAGTCTCCTTGTGGG + Intergenic
1090071222 11:123546225-123546247 ATGGACAGAAGTGTCTGTGGGGG + Intronic
1090430663 11:126643595-126643617 TTGGGCAAAAGTGCATTAGTAGG + Intronic
1092636274 12:10454210-10454232 ACAGACAAAAGTTCCTTTGAGGG + Intronic
1093733885 12:22596541-22596563 ATGGACACATGTGACTTTGAAGG + Intergenic
1094148160 12:27252277-27252299 TTCTACAAAAGTGCTTTTGTAGG - Intronic
1094833995 12:34313737-34313759 ATGGACGAAAGTGCCTTCTCAGG - Intergenic
1095881401 12:47141257-47141279 ATGGACAAAAGTGCCTTTGTGGG + Intronic
1095925056 12:47570095-47570117 ATGGAAAGTAGTGCTTTTGTTGG - Intergenic
1096436647 12:51596617-51596639 GAGGGCAAAAGTGCCTTTGAAGG + Intronic
1097414213 12:59294686-59294708 ATGGGCATAAGTACCTTTGGAGG + Intergenic
1098659516 12:73074982-73075004 ATGGAAAAAAGTCTCTTTGTGGG + Intergenic
1098666659 12:73171591-73171613 ATTGACAAAAATGCATTTTTTGG + Intergenic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099231222 12:80027616-80027638 ATGTTCAAAAGTGCCTTTGTGGG - Intergenic
1099644874 12:85340160-85340182 ATGAAAAAAAGTGACTTTTTGGG + Intergenic
1101527784 12:105547510-105547532 ATGGACCATGGTGTCTTTGTTGG + Intergenic
1102230905 12:111261568-111261590 ATGGACAAGAGTGAGTTTCTGGG - Intronic
1103753437 12:123183575-123183597 AAGGAAAAAAGTGCCTTAGCAGG + Intronic
1108615978 13:52132515-52132537 ATGCACAAAAGAGCCTGGGTTGG - Intergenic
1111256568 13:85677250-85677272 GAGGACTAAACTGCCTTTGTAGG - Intergenic
1111303902 13:86381948-86381970 AAGGACTAGACTGCCTTTGTAGG + Intergenic
1113993156 14:16045004-16045026 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1114305309 14:21418031-21418053 ATATACAAACGTGACTTTGTAGG - Intronic
1114933132 14:27500703-27500725 ATGTGCAAAAGTGCCTATTTTGG + Intergenic
1116229046 14:42192688-42192710 ATGGGCAAAAGTATCTTTGTGGG - Intergenic
1116681974 14:47983842-47983864 ATGGACAAAAGAGCCTTTGTGGG + Intergenic
1117305609 14:54470558-54470580 AGGGAGAAAAGTGCTTCTGTTGG + Intergenic
1118379809 14:65208454-65208476 AGGGACTAGATTGCCTTTGTAGG - Intergenic
1120130051 14:80795982-80796004 ATTGAGGAAAGTGCTTTTGTTGG - Intronic
1120264579 14:82232847-82232869 AGGGACAAAAATTCCTTTCTTGG + Intergenic
1120998250 14:90433180-90433202 AGGGACTAGATTGCCTTTGTAGG + Intergenic
1121764118 14:96470677-96470699 ACAGAGAAAAGTGCCTTTGAGGG + Intronic
1123501228 15:20882848-20882870 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123558480 15:21456553-21456575 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1123594711 15:21893828-21893850 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1130103966 15:80915224-80915246 AGGGACTAAACTGCTTTTGTAGG - Intronic
1130718592 15:86363193-86363215 GCAGACAAAAGTGCCTTTGTAGG - Intronic
1130833890 15:87630661-87630683 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1131606198 15:93905346-93905368 TTGGACAAAAGTACCCTTCTTGG + Intergenic
1202966830 15_KI270727v1_random:183703-183725 ATGGACAAAAGTGCCTTTATGGG - Intergenic
1133235324 16:4384861-4384883 ATCGTCAAAGGGGCCTTTGTGGG + Intronic
1133957237 16:10455174-10455196 ATGGTGAAAAGAGTCTTTGTAGG + Intronic
1134302737 16:13006003-13006025 AGGGACACACATGCCTTTGTGGG - Intronic
1138825095 16:60309332-60309354 GGGGACTAAATTGCCTTTGTAGG - Intergenic
1139174741 16:64673411-64673433 ATCTACAAAAGTTCCCTTGTTGG + Intergenic
1142049689 16:87950387-87950409 ATGTGCAAATGTGCGTTTGTGGG - Intronic
1143305032 17:5939754-5939776 GTGGCCAAAAGTGCATTTCTTGG - Intronic
1143865715 17:9921657-9921679 TGGGACAAGAATGCCTTTGTTGG + Intronic
1146668862 17:34723144-34723166 AGGGCCAAATGTCCCTTTGTTGG + Intergenic
1147481038 17:40762834-40762856 ACAGGCAAAAGTGCCTTTGTAGG - Intergenic
1147662789 17:42125908-42125930 AGGGGGAAAAGTGCATTTGTTGG + Intronic
1148221803 17:45868150-45868172 GAGGACTAAACTGCCTTTGTAGG + Intergenic
1148987252 17:51633776-51633798 ATGGAAAAAAGGGACTCTGTGGG - Intronic
1150606653 17:66697351-66697373 ATGGACAAGAGTGTCTTTGTAGG + Intronic
1151882068 17:76901974-76901996 ATGGGCACACGTGCCATTGTGGG + Intronic
1157259765 18:46167824-46167846 GTGGAGAGAAGTGACTTTGTGGG - Intergenic
1157751827 18:50185837-50185859 AATGGCAAAATTGCCTTTGTAGG + Intronic
1159624005 18:70670450-70670472 GTGGACAAAAGTGCCTTTGTGGG - Intergenic
1159843037 18:73423068-73423090 TTGTACAAAAGTGTCTTTTTAGG + Intergenic
1165494082 19:36141736-36141758 ATGGAGAAAAATGCCCTGGTAGG + Intronic
1166035074 19:40162105-40162127 ATGGACCACAGTGCCTGTGAGGG + Intergenic
1166419883 19:42628413-42628435 AGGGACTAGAATGCCTTTGTAGG + Intronic
1166497980 19:43318567-43318589 GGGGACAAGACTGCCTTTGTGGG - Intergenic
1167869170 19:52353359-52353381 ATGGACAAAAGTGTATTTATAGG + Intronic
1167957331 19:53076736-53076758 ATGGACCAAATTGTCTTTGTGGG + Intronic
1168590668 19:57632032-57632054 ATGAACAAAACTGACTTTGCAGG + Intronic
925408436 2:3624753-3624775 ATGAACAAAAGTGTCTTTGTAGG - Intronic
925947891 2:8882606-8882628 ATGGGCAAAAATGCCATTTTGGG - Intronic
926352656 2:12010993-12011015 GTTGGTAAAAGTGCCTTTGTAGG + Intergenic
927375394 2:22407398-22407420 ATGGACAAGACAGCGTTTGTCGG + Intergenic
929372445 2:41242224-41242246 ACGAACAAAAGTGCCTTTGTGGG - Intergenic
930133157 2:47873565-47873587 AGAGACACAAGTGCCTTTGAGGG - Intronic
931148626 2:59547638-59547660 ATGGAAAAAAGTGGCTTGCTAGG + Intergenic
932235066 2:70114393-70114415 ATGAGCAAAAATGCCTCTGTGGG + Intergenic
932254780 2:70275149-70275171 ACGGACATCAATGCCTTTGTGGG + Exonic
932985061 2:76716094-76716116 ATTGACAAATGTCCCTTTGGTGG - Intergenic
933350583 2:81147304-81147326 ATGTACAAAAGGGTCTTCGTGGG - Intergenic
933994057 2:87654996-87655018 ATGGACAAATGTGTCATTGAAGG - Intergenic
934701065 2:96440537-96440559 AGGGACTAGACTGCCTTTGTAGG + Intergenic
935464412 2:103379430-103379452 ATGAACAACAGTACCTTTCTGGG - Intergenic
936299807 2:111295918-111295940 ATGGACAAATGTGTCATTGAAGG + Intergenic
938538540 2:132265858-132265880 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
939745549 2:145961740-145961762 ATGGACAAGAGTACATTTGTGGG - Intergenic
940082809 2:149823691-149823713 ATGAACAAGAGTGCCTTTTTTGG - Intergenic
942223708 2:173796329-173796351 GGGGACTAAACTGCCTTTGTAGG + Intergenic
942475556 2:176316172-176316194 GTGGACCAAATAGCCTTTGTAGG + Intronic
943348388 2:186769114-186769136 AAAGGCAAAAGTGGCTTTGTGGG + Intergenic
946016924 2:216611399-216611421 ATGGACAAAATTGCATTTCAGGG - Intergenic
947665884 2:231905064-231905086 TGGGAGAAAAGTGCCTTTGGGGG - Intergenic
948262621 2:236615249-236615271 ATGGGCACAGGTGCCTTTGGAGG + Intergenic
948761349 2:240193560-240193582 ATGGTCAGAAGTGCCATTGCGGG + Intergenic
948810261 2:240471698-240471720 ACACACAAAAGTGCCTTCGTGGG + Intergenic
1169511083 20:6264674-6264696 ATAGAAAAAAGTTTCTTTGTTGG + Intergenic
1169721055 20:8676826-8676848 AGGGAAAAAAGTAACTTTGTAGG + Intronic
1169824726 20:9754651-9754673 ATGAACCAGACTGCCTTTGTAGG - Intronic
1169904461 20:10587515-10587537 ATGAAGAAAAGTCCCTTTTTTGG + Intronic
1171811867 20:29750842-29750864 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1171907805 20:30914855-30914877 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1172301330 20:33852590-33852612 ATGGCCAAATGTCCCTTGGTAGG + Intronic
1174417712 20:50378533-50378555 ACGGACAAAAATTCCTTTGCTGG + Intergenic
1176980923 21:15380055-15380077 TAAGACAAAAGTGGCTTTGTAGG + Intergenic
1177390202 21:20459503-20459525 ATGGATAAAAGTGTCTTCGTGGG + Intergenic
1177420605 21:20852041-20852063 GGGGACAAGACTGCCTTTGTAGG - Intergenic
1178086794 21:29120297-29120319 ATGGCTCAAATTGCCTTTGTAGG - Intronic
1180195869 21:46193944-46193966 GTGGACACAGGTGCCTGTGTGGG + Intronic
1180314112 22:11262509-11262531 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1180341246 22:11621025-11621047 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1181429467 22:22869847-22869869 ATAGAAAAAAATGCCTTTGATGG - Intronic
1182963987 22:34504430-34504452 ATGGACAAAGGTGCAATTTTCGG - Intergenic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
952086774 3:29832401-29832423 ATGGATGAGAGTACCTTTGTGGG + Intronic
953075945 3:39570506-39570528 ATCGACAAAGGTGCATTTGCTGG - Intergenic
953220030 3:40961074-40961096 ATGGACAAATGTGCCTTTGTAGG - Intergenic
954493700 3:50931985-50932007 ATGGACAAGAGTACCTTTGTGGG - Intronic
956840309 3:73134125-73134147 GGGAAGAAAAGTGCCTTTGTAGG + Intergenic
957507033 3:81135310-81135332 ATGGACATAAAATCCTTTGTTGG + Intergenic
959816951 3:110684824-110684846 AAGGACAAAACTGACTTTTTCGG - Intergenic
959851236 3:111089709-111089731 CTTGAAAAAATTGCCTTTGTTGG + Intronic
961653269 3:128428066-128428088 ATGGACAAAAGCCCCCATGTGGG + Intergenic
964331067 3:155603605-155603627 ATAGAGAAAAATGCCTTTTTAGG - Intronic
964366244 3:155953630-155953652 AGGGACTAGATTGCCTTTGTAGG - Intergenic
964642623 3:158926347-158926369 ATGAGCAACAGTGCCTTTGTGGG + Intergenic
965837956 3:172871684-172871706 ATGAACATAAGTGCCGTTGGGGG + Intergenic
966567259 3:181396902-181396924 ATGGAAAAAAGTGCCATTGTGGG - Intergenic
966626785 3:182025408-182025430 ATGGACAACTGGGCCTCTGTGGG + Intergenic
967388801 3:188935178-188935200 GTAGACAAAAGTGCCTTTGGAGG + Intergenic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
970497654 4:16643159-16643181 AGGGATAAAAGTATCTTTGTGGG + Intronic
972512917 4:39786338-39786360 AAGGATAAAAGTGCCTATGTGGG + Intergenic
972743778 4:41913484-41913506 GGGGACAAGAATGCCTTTGTAGG + Intergenic
973235515 4:47898990-47899012 GTGGACAGAAGTTGCTTTGTGGG - Exonic
973770045 4:54198053-54198075 ATGGATAAAAATGCCATTGGGGG - Intronic
974100236 4:57408225-57408247 CTGGAAAATAGTGACTTTGTGGG + Intergenic
974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG + Intergenic
974721406 4:65743631-65743653 TTTGAAAAAATTGCCTTTGTTGG - Intergenic
977045503 4:92064370-92064392 ATGGAAAAAAGTACCTTTCTGGG + Intergenic
978211860 4:106146853-106146875 ATGGAGAGAAGTTCTTTTGTGGG - Intronic
979115163 4:116814537-116814559 ATGGAGAACAGTGCCTGTGTGGG - Intergenic
979801461 4:124914177-124914199 ATAGACAAAATTGCCTTTGTGGG - Intergenic
979869142 4:125794704-125794726 ATGGGCAAAATTGGCTTGGTTGG + Intergenic
980626611 4:135381436-135381458 AGGGACTAAACTGCCTTTGTAGG + Intergenic
980706653 4:136505245-136505267 ATGTAGAAATGTGCCTATGTCGG + Intergenic
980773631 4:137411409-137411431 ATGGACAGAATTGCCTTTTGTGG - Intergenic
980813180 4:137910276-137910298 GTGGAGAAAAGTGGCTTAGTTGG - Intergenic
981261203 4:142721353-142721375 TTGCACAAAAATGCTTTTGTTGG + Intronic
982166009 4:152614206-152614228 ATGGACAAAGGTGTCATTGAAGG + Intergenic
982395610 4:154912056-154912078 ACAGACAAAAGTGCCTTTAAGGG - Intergenic
982778422 4:159465775-159465797 ATAGACAAAAGTTTCTTTGTGGG - Intergenic
983946451 4:173591098-173591120 ATGGAGAAAAATCCCTTTCTGGG - Intergenic
986135460 5:4973541-4973563 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986135470 5:4973607-4973629 ATAGACAAAAGTGTCGTTGGAGG - Intergenic
986747172 5:10754871-10754893 ATGGGGAAAAGTGACTTTGGTGG + Intronic
989310324 5:40009213-40009235 ATGGATAAAAGTACCATTGTGGG - Intergenic
990208785 5:53458859-53458881 AGGGACTAGATTGCCTTTGTAGG + Intergenic
991291543 5:65037728-65037750 ATGGAGAAAACTGGCTTGGTTGG - Intergenic
992417645 5:76566966-76566988 ATGGACAGAAGGGCCTTCCTTGG + Intronic
992824738 5:80537514-80537536 ATGGATAAAAGTACCTTTGTGGG - Intronic
993194393 5:84722445-84722467 ATGGACAAAAGTGCCTTTGTGGG + Intergenic
994793158 5:104258041-104258063 ATGGACAAGAATACCTTTATGGG - Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
995281299 5:110338682-110338704 GTGGACCAACCTGCCTTTGTAGG - Intronic
995852684 5:116562665-116562687 ATGGACAAAAGTGTCATTGAAGG - Intronic
995882969 5:116863255-116863277 ATGGACAACTGGGCCTTTGTGGG - Intergenic
996150633 5:120030151-120030173 AGAGGCAAAAGTGCCTGTGTGGG - Intergenic
996174459 5:120337970-120337992 ATGTACAAAAAGGCCTTTCTTGG - Intergenic
997554553 5:134784007-134784029 ATGGACAAAAGTTTCTTTTTGGG - Intronic
998337094 5:141383014-141383036 ACGGACAAAGGGTCCTTTGTGGG + Exonic
999294140 5:150447605-150447627 ATGGACAAAAGTGTCATTGAAGG + Exonic
999879879 5:155850526-155850548 ATGATCAAAAGTGACATTGTGGG + Intergenic
1001206131 5:169764791-169764813 ATGAATAAAAGGGCCTTGGTTGG + Intronic
1002311534 5:178318156-178318178 ATGAACAAGAGGGCCTTTTTTGG - Intronic
1002676135 5:180914760-180914782 ATGAACAAAAGTATTTTTGTAGG + Intronic
1003703248 6:8494367-8494389 ATGCAGAAAAGTGAATTTGTGGG - Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1008477644 6:51949526-51949548 ATGGACACAGCTTCCTTTGTTGG + Intronic
1008679711 6:53859127-53859149 GTGGACAAAGCTGCCTCTGTAGG + Intronic
1009625775 6:66137647-66137669 GGGGACTAAATTGCCTTTGTAGG + Intergenic
1010464990 6:76157296-76157318 ATGGACAAAGGTGACTTGGGGGG - Intergenic
1010843628 6:80678324-80678346 CTGGACTCAACTGCCTTTGTAGG - Intergenic
1011411246 6:87068907-87068929 ATGGACAGATGTGACTTTGAAGG - Intergenic
1014774440 6:125492447-125492469 AAGCAAAAAAGTGCCTTTATAGG - Intergenic
1014894013 6:126877789-126877811 ATGGACAAGAGTATCCTTGTAGG - Intergenic
1016550952 6:145279408-145279430 ATGGGCAATACTGCCTTTGGTGG + Intergenic
1018151176 6:160940728-160940750 ATGGACAAAAGTGCCTCTGTGGG - Intergenic
1018484062 6:164222450-164222472 ATGGAAAATGGTGCCTTTGGGGG + Intergenic
1018682583 6:166276108-166276130 TTGGACAACAGAGCCATTGTTGG - Intergenic
1020840254 7:13208807-13208829 AAAGACAAAAGTGCCTTTCTGGG - Intergenic
1022192540 7:28030963-28030985 AATGACAACTGTGCCTTTGTTGG - Intronic
1022596208 7:31715537-31715559 TTGGACAAAAATGCCTTTACAGG - Intergenic
1024281215 7:47721365-47721387 ATTGCCAAATGTCCCTTTGTGGG + Intronic
1024358304 7:48441587-48441609 AAGGACAAAAGTGCAGTTGCAGG - Intronic
1024430141 7:49278919-49278941 ATGGAGAAGAGTGCCTTTCAAGG + Intergenic
1024778348 7:52815993-52816015 ATAGACAAAACTGCCTTTGTGGG + Intergenic
1025252932 7:57364016-57364038 ATGGACAAAAATTCCTTTGCTGG - Intergenic
1028511467 7:91629622-91629644 ATGGGGAAAAGGGCCTTTGCTGG + Intergenic
1028897428 7:96057955-96057977 ATGGACTGAGGTGTCTTTGTAGG - Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1031692761 7:124810817-124810839 AAGAACAAAAATCCCTTTGTAGG - Intergenic
1032382775 7:131502286-131502308 ATGGAGAACAGTGCCTGTTTGGG - Intronic
1033627557 7:143125405-143125427 GGGGACAAGATTGCCTTTGTAGG + Intergenic
1035859134 8:3009168-3009190 AGGGGCAAAAGTGCGTGTGTGGG - Intronic
1036162196 8:6399578-6399600 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1037662883 8:20942210-20942232 TTGGACCAAAGTGCCTTGGTTGG - Intergenic
1037987370 8:23298431-23298453 AAGGAAAAAAGTGTCTTTATTGG + Intronic
1039222220 8:35345128-35345150 ATGGAGAAAAGTGTATTTTTAGG - Intronic
1040535893 8:48309465-48309487 ACAGTCAAAAGTGCCTCTGTGGG + Intergenic
1043885008 8:85588855-85588877 AGGGACAAAACTAGCTTTGTGGG - Intergenic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1045690869 8:104758585-104758607 AGGGACTAGATTGCCTTTGTAGG - Intronic
1045811888 8:106231534-106231556 AAAGACAAAAATGCCTTTGTGGG + Intergenic
1046685046 8:117215593-117215615 AGGGGTGAAAGTGCCTTTGTTGG - Intergenic
1046696306 8:117343759-117343781 ATGGATGAGAGTACCTTTGTGGG + Intergenic
1050664928 9:7925024-7925046 ATGTACCAAAGTTCATTTGTTGG - Intergenic
1051631011 9:19140974-19140996 AGGGACTAGACTGCCTTTGTAGG + Intronic
1051963704 9:22800695-22800717 TGGGAAAAAAGTGCCTTTGTAGG + Intergenic
1052116367 9:24652394-24652416 GGGAAAAAAAGTGCCTTTGTGGG - Intergenic
1052755566 9:32537455-32537477 ATAGACAAAAAAGCATTTGTGGG - Intergenic
1053855171 9:42331181-42331203 AGGGACTAGACTGCCTTTGTAGG - Intergenic
1054569114 9:66790770-66790792 AGGGACTAGACTGCCTTTGTAGG + Intergenic
1056285636 9:85084970-85084992 AGGTACAAAATTGTCTTTGTTGG + Intergenic
1058973013 9:110100485-110100507 ATGTACACAAAGGCCTTTGTGGG - Intronic
1061221194 9:129253251-129253273 CTGGACAAAGGGGCCTTTGGAGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1203362424 Un_KI270442v1:228628-228650 GTGAACAAAAGTGCCTCTGCTGG - Intergenic
1186750751 X:12619432-12619454 ATGGACAAAAGTGGCTTTGTGGG + Intronic
1187732581 X:22270886-22270908 ATGGACACTGGTGCCTTTGGTGG + Intergenic
1188049665 X:25469184-25469206 ATGGAAAGTAGTGGCTTTGTAGG + Intergenic
1188999764 X:36931356-36931378 TGGGACTAAACTGCCTTTGTAGG - Intergenic
1189409410 X:40756339-40756361 ACAGACAAAAGTGTCTTTGTGGG - Intergenic
1190512182 X:51184942-51184964 ATGGACAAAAGTCTCTTTGTGGG + Intergenic
1190870397 X:54420198-54420220 AGGGCCAGAAGTGGCTTTGTAGG + Intergenic
1192013221 X:67298565-67298587 ACAGACAAAAGTGCCTTCTTGGG + Intergenic
1192299512 X:69885622-69885644 ACAGACAAAATTGTCTTTGTAGG + Intronic
1192332665 X:70190360-70190382 ATGGACCAAAGTACCTTTGTGGG + Intronic
1193632928 X:83911948-83911970 ATGCATAAAAGTGCTTTTGTAGG + Intergenic
1194534847 X:95094022-95094044 ATTGACAAAAGTGTCTTTGTGGG + Intergenic
1194542499 X:95191363-95191385 ATAGACAAGAGTGCTTGTGTAGG + Intergenic
1195107838 X:101617513-101617535 AAGGAGAAAACTGCCTTGGTTGG - Exonic
1195793977 X:108622920-108622942 ATGCATTTAAGTGCCTTTGTTGG - Intronic
1199027485 X:142956951-142956973 ACAGTCAAAAGTGCCTTTATGGG - Intergenic
1199200416 X:145081183-145081205 ATGGACAAAAGTGGCTGAGTTGG - Intergenic
1199347634 X:146760772-146760794 ATGGACAAAAGTGCCTTTGTAGG + Intergenic
1199875667 X:151925999-151926021 ATGGACGAAACTTCCTTTTTTGG + Intergenic
1200290104 X:154863667-154863689 ATGGACAAAAGTGTCTTTGTGGG + Intronic
1201075824 Y:10187632-10187654 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1201749024 Y:17412575-17412597 ATAGACTAGATTGCCTTTGTAGG + Intergenic
1201774464 Y:17648308-17648330 GTGAACAAAAGTGCCTCTGCTGG + Intergenic
1201827092 Y:18257681-18257703 GTGAACAAAAGTGCCTCTGCTGG - Intergenic