ID: 1095883320

View in Genome Browser
Species Human (GRCh38)
Location 12:47162556-47162578
Sequence CCCTCACCAGAAGCAGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2183
Summary {0: 6, 1: 57, 2: 371, 3: 760, 4: 989}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095883320_1095883329 22 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883329 12:47162601-47162623 ATGGAAGGCAAAGAGGGAGCAGG 0: 3
1: 43
2: 261
3: 763
4: 2143
1095883320_1095883327 15 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883327 12:47162594-47162616 AATCATGATGGAAGGCAAAGAGG 0: 73
1: 818
2: 2388
3: 4460
4: 5949
1095883320_1095883328 16 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883328 12:47162595-47162617 ATCATGATGGAAGGCAAAGAGGG 0: 7
1: 96
2: 591
3: 1228
4: 2767
1095883320_1095883324 3 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883324 12:47162582-47162604 CAGGAAGCCTAAAATCATGATGG 0: 1
1: 1
2: 81
3: 930
4: 4749
1095883320_1095883325 7 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883325 12:47162586-47162608 AAGCCTAAAATCATGATGGAAGG 0: 1
1: 0
2: 69
3: 756
4: 3970

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095883320 Original CRISPR CCCTCACCAGAAGCAGATAT TGG (reversed) Intronic
Too many off-targets to display for this crispr