ID: 1095883324

View in Genome Browser
Species Human (GRCh38)
Location 12:47162582-47162604
Sequence CAGGAAGCCTAAAATCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5762
Summary {0: 1, 1: 1, 2: 81, 3: 930, 4: 4749}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095883320_1095883324 3 Left 1095883320 12:47162556-47162578 CCAATATCTGCTTCTGGTGAGGG 0: 6
1: 57
2: 371
3: 760
4: 989
Right 1095883324 12:47162582-47162604 CAGGAAGCCTAAAATCATGATGG 0: 1
1: 1
2: 81
3: 930
4: 4749

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095883324 Original CRISPR CAGGAAGCCTAAAATCATGA TGG Intronic
Too many off-targets to display for this crispr