ID: 1095883324 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:47162582-47162604 |
| Sequence | CAGGAAGCCTAAAATCATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5762 | |||
| Summary | {0: 1, 1: 1, 2: 81, 3: 930, 4: 4749} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095883320_1095883324 | 3 | Left | 1095883320 | 12:47162556-47162578 | CCAATATCTGCTTCTGGTGAGGG | 0: 6 1: 57 2: 371 3: 760 4: 989 |
||
| Right | 1095883324 | 12:47162582-47162604 | CAGGAAGCCTAAAATCATGATGG | 0: 1 1: 1 2: 81 3: 930 4: 4749 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095883324 | Original CRISPR | CAGGAAGCCTAAAATCATGA TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||