ID: 1095883608

View in Genome Browser
Species Human (GRCh38)
Location 12:47165230-47165252
Sequence AACTCAGATATGCCTCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095883608 Original CRISPR AACTCAGATATGCCTCTGGT GGG (reversed) Intronic
905125134 1:35710871-35710893 AGCTCAGATCTGCCTATGGGAGG + Intergenic
906829163 1:49013561-49013583 AACTCAGAGAAGCCTCTTCTGGG - Intronic
910413989 1:86978382-86978404 AATTCAGATATATCTCTGCTAGG + Intronic
910718622 1:90259758-90259780 AAATGAGGTATGCCTCTGTTGGG - Intergenic
911629074 1:100162007-100162029 AACCTTGATATGCCACTGGTGGG - Intronic
915361809 1:155290422-155290444 GTCTCAGATAGGCCTCAGGTAGG + Exonic
916027263 1:160844118-160844140 AACTTATATTTGCCTCTAGTTGG - Intronic
917004921 1:170404024-170404046 AACTCTCATATGCTGCTGGTGGG - Intergenic
917672178 1:177283210-177283232 AACTGAGATATACCACAGGTAGG - Intergenic
917766256 1:178220638-178220660 AAATGAGATATGCCTGTAGTTGG + Intronic
920648019 1:207817489-207817511 AACCCAGATGGGCCCCTGGTTGG - Intergenic
921020030 1:211226838-211226860 TACTTACATATGCCACTGGTTGG - Intergenic
921049578 1:211501407-211501429 AACCCAGAGATGCCCCTGGAAGG + Intergenic
1063838257 10:10041368-10041390 AAGACAGAAATGCCTCTGTTCGG - Intergenic
1064196521 10:13248107-13248129 AACTCAGATCTTCCTAAGGTAGG - Intergenic
1064853960 10:19744172-19744194 AAATCAGATATCCCTCTGTGTGG - Intronic
1070103753 10:73413451-73413473 AACACAGATTTGCTGCTGGTCGG + Intronic
1070358223 10:75661227-75661249 AACCCAGAAAGGCCTCTGCTAGG + Intronic
1074683303 10:115933107-115933129 AACTGAGTTATGCTTATGGTGGG + Intronic
1077670828 11:4155849-4155871 AACTCTCATACGCTTCTGGTGGG - Intergenic
1086317736 11:85611134-85611156 TACTTAGGTATGCCACTGGTTGG - Intronic
1086327534 11:85719246-85719268 CATTCACATATGCCTCTGGGAGG + Intronic
1092731748 12:11541313-11541335 AACTTAGATATTGCTCAGGTAGG + Intergenic
1094500578 12:31017426-31017448 AACTTAGATATTGCTCAGGTAGG - Intergenic
1094686058 12:32715989-32716011 AACTCACATATTCCTCAGATGGG + Intronic
1095883608 12:47165230-47165252 AACTCAGATATGCCTCTGGTGGG - Intronic
1096240436 12:49956937-49956959 GACTCAGATCTGCCTCTGCCTGG - Exonic
1096454461 12:51773538-51773560 AACACTCATATGCTTCTGGTAGG + Intronic
1096653936 12:53076698-53076720 CACTCAGAAAGGCCTCTGGGCGG + Intronic
1097362209 12:58670602-58670624 AACCCAGTTAAGACTCTGGTAGG - Intronic
1098065623 12:66613126-66613148 GACTAAGTTATGCCTCTGGGAGG - Intronic
1098552864 12:71783355-71783377 AACTCAGATATGCATTTTATTGG - Intronic
1098615893 12:72521668-72521690 AACACAGATATTCAGCTGGTTGG - Intronic
1100420844 12:94431814-94431836 AACTCTTATATGCTGCTGGTAGG + Intronic
1100453638 12:94731275-94731297 TAGTCAGATGTGCCTGTGGTAGG - Intergenic
1107554460 13:41505359-41505381 AAGTAAGATCTGCCTCTAGTGGG - Intergenic
1109983041 13:69936153-69936175 AACTCAGACCTTCCTCTTGTTGG - Intronic
1110314533 13:74090476-74090498 AAGTCAGTTATGATTCTGGTAGG - Intronic
1112148160 13:96724979-96725001 AACTCTCATATGCTGCTGGTTGG - Intronic
1112343376 13:98570685-98570707 AACTGAGATATGCCTTTGCTTGG - Intronic
1112478293 13:99752117-99752139 CACTCTCATATGCCGCTGGTGGG + Intronic
1113654564 13:112059587-112059609 AAATCAGATTTCCCTCAGGTTGG - Intergenic
1113744832 13:112736942-112736964 AACCCATATGTGCCTCTGGTGGG + Intronic
1113826005 13:113254183-113254205 AACTCTCATGTGCCTCTCGTGGG + Intronic
1117968407 14:61229038-61229060 AACCCAGAAATTCCACTGGTAGG + Intronic
1118665648 14:68065868-68065890 AACTCTCATATACTTCTGGTTGG + Intronic
1120475187 14:84978004-84978026 GCATCAGATATGCCACTGGTAGG + Intergenic
1120730772 14:87998728-87998750 GACTCTGATATGGCTCTTGTGGG - Intergenic
1120745861 14:88150971-88150993 AACACTTATATGCCACTGGTGGG - Intergenic
1122014550 14:98783341-98783363 AACTCATATATGGCTGTCGTTGG + Intergenic
1122150765 14:99725007-99725029 AACTCAGATCTGACTCTGTGAGG - Intronic
1122174212 14:99905297-99905319 GGCTCAGACATGCCCCTGGTCGG + Intronic
1124386007 15:29208573-29208595 AACTCACATACACCCCTGGTGGG + Intronic
1125161964 15:36654717-36654739 AACTCTGATCTGCTTCTGTTTGG + Intronic
1127077898 15:55345948-55345970 AACTCAGATATCTCTCTAATTGG + Intronic
1130246508 15:82255035-82255057 AACTCAGAAATTCTACTGGTAGG - Intronic
1130454141 15:84088098-84088120 AACTCAGAAATTCTACTGGTAGG + Intergenic
1134333569 16:13272566-13272588 AACTCTGATAACCCTCTGTTAGG - Intergenic
1137994299 16:53193085-53193107 AACTCCTATATGCTGCTGGTGGG - Intronic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1141387630 16:83636870-83636892 AACACATATATGCTGCTGGTGGG - Intronic
1143804806 17:9417572-9417594 AACTCAGATATGTTTATGCTAGG - Intronic
1143839359 17:9719496-9719518 ATCTCAGATATCCCCTTGGTAGG - Intronic
1145078845 17:19877725-19877747 AACTCTTATATGCCGTTGGTAGG + Intergenic
1145235962 17:21208640-21208662 CACTCAGATTTGCCTCTGCTGGG - Intronic
1146525521 17:33564044-33564066 AAGTCACATATTCCTGTGGTGGG + Intronic
1149210874 17:54298940-54298962 ATCTCACATATACATCTGGTGGG - Intergenic
1152869724 17:82746154-82746176 AACTCCCATATGCTGCTGGTGGG - Intronic
1153224095 18:2884770-2884792 AACTCAGATCAGCCTCAGGAAGG - Intronic
1156829745 18:41477544-41477566 AACTCATATGTACCTGTGGTAGG - Intergenic
1160459812 18:79030174-79030196 AACTCACATATACTGCTGGTGGG - Intergenic
1160672349 19:371802-371824 GTCTCAGCTATGCCTCTGCTCGG + Intronic
1165000777 19:32759967-32759989 GATTCTGATATGCCTCTTGTAGG + Intronic
1165917089 19:39267364-39267386 CACACATATATGCCTCTGGCCGG + Intergenic
1167485165 19:49758486-49758508 GACTCAGAAATAGCTCTGGTGGG + Intronic
1167718916 19:51164131-51164153 AACTCATATATTCTGCTGGTGGG + Intergenic
924969241 2:109123-109145 ACCTCAGATCTGCCACTGCTGGG + Intergenic
928744321 2:34393929-34393951 CTCTCAGTTAAGCCTCTGGTGGG - Intergenic
930429055 2:51251017-51251039 AAGTCAGAGATGCCTCTAATTGG - Intergenic
931598599 2:63978282-63978304 AACTCTCATATACCGCTGGTGGG - Intronic
933848089 2:86341995-86342017 AACTCTCATATGCTGCTGGTGGG + Intergenic
936526692 2:113246335-113246357 AACTCAGATATCACTCTTTTAGG + Intronic
938220602 2:129563327-129563349 AACTCTGTTATGCCACTGGTGGG - Intergenic
938569726 2:132551617-132551639 TCCTCAGATAAGCCTTTGGTTGG - Intronic
941906614 2:170722485-170722507 AACTCATTTATGCTTATGGTTGG + Intergenic
943089458 2:183357078-183357100 AAGTCAGGTCTCCCTCTGGTGGG + Intergenic
943712834 2:191116916-191116938 AACTCAAATATCCCTCCCGTTGG + Intronic
944227746 2:197364959-197364981 AACTCAGTTTTGCCTTTGGTGGG + Intergenic
1170899262 20:20444685-20444707 AACTCTGAAATGCTGCTGGTGGG - Intronic
1173137141 20:40448315-40448337 AAATTAGAAATGCCTCTGCTTGG + Intergenic
1174827748 20:53783883-53783905 AACTCTCATATACCACTGGTAGG + Intergenic
1174879865 20:54267432-54267454 TACTCTGATATGCCTTTGCTAGG + Intergenic
1175431439 20:58907154-58907176 AAATCATATAAGCCTCTGTTAGG + Intronic
1177321538 21:19527592-19527614 AACTCTCATTTGTCTCTGGTAGG - Intergenic
1178212298 21:30549880-30549902 AATTCAGATGTGACTCTGTTTGG + Intronic
1182279012 22:29207492-29207514 AACTCAGAAATCCCACTGTTAGG + Intronic
1182428046 22:30285242-30285264 ACCTCCGTTCTGCCTCTGGTGGG - Exonic
1184618281 22:45653240-45653262 AAATCAGATAGGCATCTGCTTGG - Intergenic
949808997 3:7985743-7985765 AACTCAGCTCTGCCTTTGGAGGG + Intergenic
950687382 3:14628167-14628189 CACTAAGAGATGTCTCTGGTGGG - Intergenic
953545968 3:43863792-43863814 CACCCAGAAATGCCTCTGATGGG - Intergenic
958597960 3:96255087-96255109 AACGCTGATATGAGTCTGGTGGG + Intergenic
959373598 3:105560154-105560176 AACTCTCATATGCGACTGGTGGG - Intronic
959600913 3:108184234-108184256 AATTCAGATCTGCCTCAAGTTGG - Intronic
960220670 3:115104899-115104921 AACAAATATATGACTCTGGTGGG + Intronic
964448565 3:156786984-156787006 AACTCACAGATCCCTCTGGGAGG - Intergenic
964626163 3:158762092-158762114 AAGTCAGATACCCCTCTGATGGG + Intronic
965435316 3:168643493-168643515 AACTCTAATATACCACTGGTGGG + Intergenic
969930360 4:10625113-10625135 AGCTCAGAGATGCCTTTGATAGG + Intronic
970250923 4:14115209-14115231 AACTCAGATCTGCACCTGGAAGG - Intergenic
976348195 4:84029560-84029582 AACACGTATATGCCACTGGTAGG + Intergenic
978404459 4:108364574-108364596 ACCTCAGATATGCCTATGCCTGG - Intergenic
978630807 4:110742025-110742047 AACTTAAATATGCCTCTGCAGGG - Intergenic
978979874 4:114930208-114930230 ATCTCAGATATAGCTTTGGTTGG + Intronic
984030933 4:174603263-174603285 AACTCTGATATGCCTCAACTAGG + Intergenic
984236368 4:177163779-177163801 AACACATATATACCGCTGGTGGG + Intergenic
984990989 4:185380693-185380715 CACTCAGATATATCTTTGGTTGG + Intronic
986566285 5:9118547-9118569 AACTCAGTTAATCCTCTGGAAGG - Intronic
990201873 5:53384947-53384969 AACTCTGTTTTGCCTATGGTAGG - Intergenic
991146926 5:63318092-63318114 AACTAATATCTGGCTCTGGTAGG - Intergenic
993899712 5:93576717-93576739 AACTCAGATCTACTTCTGATGGG + Intergenic
995107008 5:108386284-108386306 AACTCAAATCTACCTCAGGTTGG - Intergenic
996066712 5:119087568-119087590 ACCTCAGATATGTCTCTTCTTGG + Intronic
996599997 5:125252297-125252319 AACTCACATATTCCTCCTGTAGG + Intergenic
999650397 5:153761547-153761569 AACTCTTATATGCCGCTGGTGGG + Intronic
1000060208 5:157648450-157648472 AAATCAGATATCCCTTTGCTTGG + Intronic
1003274624 6:4638830-4638852 AACTCCGATATGCTGCTGGTGGG - Intergenic
1005877001 6:30018664-30018686 AGGTCAGAGATGCATCTGGTTGG - Intergenic
1006678449 6:35779947-35779969 AATGCAGAAATGCCTGTGGTGGG + Intergenic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007407627 6:41644072-41644094 AGCTCAGATATGGCTCTTGAAGG - Intronic
1009514461 6:64597246-64597268 AACCCTTATATGCTTCTGGTAGG + Intronic
1011725513 6:90206447-90206469 AACTCTGAAATGCTTCTGGCAGG + Intronic
1015730731 6:136345468-136345490 AACTCAGATCTTTCTCTAGTGGG + Intronic
1015746681 6:136517246-136517268 CAGTCACATATGCCTATGGTAGG + Intronic
1015964367 6:138683252-138683274 AACACAAAAATACCTCTGGTTGG - Intronic
1018838702 6:167503935-167503957 AACCAAGATATGTCTGTGGTAGG - Intergenic
1021669619 7:23022244-23022266 AACTCTCATATTCCACTGGTGGG - Intergenic
1023651913 7:42379676-42379698 AACTCTGATATTCCTCTGATTGG + Intergenic
1024736743 7:52313222-52313244 AACTCAAATATGCCTGTATTTGG + Intergenic
1026135918 7:67660642-67660664 AACTCAGATATGCCTGTTGTGGG + Intergenic
1028854093 7:95570153-95570175 AACTCTGATATACTACTGGTGGG - Intergenic
1029181563 7:98705517-98705539 ATCTCAGAAATGCTTCTGGCAGG + Intergenic
1035299352 7:157887155-157887177 ACCCCAGATAAGCCTTTGGTTGG - Intronic
1035551999 8:535712-535734 CGCTCAGACCTGCCTCTGGTGGG - Intronic
1036388714 8:8306119-8306141 AACTCAGACATGCCTTTACTGGG + Intergenic
1038333340 8:26627122-26627144 ATCCCAGAAATGCCTCTGGTGGG + Intronic
1039546480 8:38414552-38414574 AACTCACACATCACTCTGGTGGG + Exonic
1039986646 8:42453117-42453139 CACCCAGTTAAGCCTCTGGTAGG - Intronic
1040586693 8:48750121-48750143 GACTCAGATCTGCCTCTGCCTGG - Intergenic
1042126968 8:65548047-65548069 AAGGCAGACATTCCTCTGGTTGG - Intergenic
1042131520 8:65591323-65591345 ACCTCAAATATGCCTCAGATGGG + Intergenic
1046224737 8:111262879-111262901 AACTCAGATTTCCTTCTGTTAGG - Intergenic
1046758208 8:117992996-117993018 AACTCATATGTCCCTCTGGTTGG - Intronic
1047141376 8:122143662-122143684 TGCTCAGATATGCCGGTGGTGGG - Intergenic
1050961926 9:11745029-11745051 AACTGAGATATCACTGTGGTAGG - Intergenic
1051511392 9:17881985-17882007 AACTCAGACATGTGTCTGTTGGG - Intergenic
1056457739 9:86778865-86778887 AACTCAGAAATTCTTCAGGTTGG - Intergenic
1057104177 9:92395622-92395644 AACTCTCATATGCTGCTGGTAGG - Intronic
1057639810 9:96808030-96808052 GACTCAGAAATCCCTCTGCTTGG + Intergenic
1057951763 9:99374522-99374544 TTCTCAAATATGCCTCAGGTTGG + Intergenic
1057972358 9:99570297-99570319 AACTCAGAAATTCCTTTGGGAGG - Intergenic
1059499170 9:114736428-114736450 AATTTAGATGTGCCTCTGGGGGG + Intergenic
1059757960 9:117311379-117311401 AACTGGTATGTGCCTCTGGTGGG - Intronic
1060214753 9:121731996-121732018 GACACAGAAATGGCTCTGGTGGG + Intronic
1062077109 9:134595402-134595424 AACTCAGGTCTGCCCCAGGTGGG - Intergenic
1186252533 X:7683983-7684005 AACTCTCAAATGCTTCTGGTGGG - Intergenic
1187335546 X:18378125-18378147 AACTGTCATATGCCTCGGGTGGG + Intergenic
1191058264 X:56266649-56266671 AAAACAGATATACCTCTGGGAGG - Intronic
1194034788 X:88856596-88856618 AACTAAGCTGTGCCTCTGGGTGG - Intergenic
1197129167 X:122984279-122984301 CTCTAAGATATGCCTGTGGTTGG - Intergenic
1202035620 Y:20631880-20631902 AACTCAGATATGCCATTTTTAGG + Intergenic
1202258171 Y:22941947-22941969 TACTTAGGTATGCCACTGGTTGG - Intergenic
1202411161 Y:24575705-24575727 TACTTAGGTATGCCACTGGTTGG - Intergenic
1202459620 Y:25094367-25094389 TACTTAGGTATGCCACTGGTTGG + Intergenic