ID: 1095884786

View in Genome Browser
Species Human (GRCh38)
Location 12:47177574-47177596
Sequence CTAAGGCATCAGTACAACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 79}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095884786_1095884794 -1 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884794 12:47177596-47177618 GTCCAGCCTGGTGGTGGGGTGGG 0: 1
1: 0
2: 8
3: 69
4: 551
1095884786_1095884800 5 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884800 12:47177602-47177624 CCTGGTGGTGGGGTGGGGGGTGG 0: 1
1: 8
2: 76
3: 700
4: 7207
1095884786_1095884791 -6 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884791 12:47177591-47177613 CCTTAGTCCAGCCTGGTGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 372
1095884786_1095884793 -2 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884793 12:47177595-47177617 AGTCCAGCCTGGTGGTGGGGTGG 0: 1
1: 1
2: 4
3: 59
4: 499
1095884786_1095884789 -7 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884789 12:47177590-47177612 GCCTTAGTCCAGCCTGGTGGTGG 0: 1
1: 0
2: 3
3: 17
4: 206
1095884786_1095884801 19 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884801 12:47177616-47177638 GGGGGGTGGCAACTAGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 125
1095884786_1095884797 1 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884797 12:47177598-47177620 CCAGCCTGGTGGTGGGGTGGGGG 0: 1
1: 1
2: 8
3: 116
4: 895
1095884786_1095884795 0 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884795 12:47177597-47177619 TCCAGCCTGGTGGTGGGGTGGGG 0: 1
1: 1
2: 13
3: 84
4: 696
1095884786_1095884788 -10 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884788 12:47177587-47177609 GATGCCTTAGTCCAGCCTGGTGG 0: 1
1: 0
2: 0
3: 18
4: 195
1095884786_1095884792 -5 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884792 12:47177592-47177614 CTTAGTCCAGCCTGGTGGTGGGG 0: 1
1: 0
2: 1
3: 24
4: 260
1095884786_1095884802 22 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884802 12:47177619-47177641 GGGTGGCAACTAGAAACTGGAGG 0: 1
1: 0
2: 1
3: 4
4: 139
1095884786_1095884798 2 Left 1095884786 12:47177574-47177596 CCTATGTTGTACTGATGCCTTAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1095884798 12:47177599-47177621 CAGCCTGGTGGTGGGGTGGGGGG 0: 1
1: 3
2: 21
3: 151
4: 1169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095884786 Original CRISPR CTAAGGCATCAGTACAACAT AGG (reversed) Intronic
901914698 1:12489466-12489488 CAATGGCAATAGTACAACATGGG + Intronic
905198236 1:36298224-36298246 CTAATGCATAAGTAACACATTGG - Intronic
905559881 1:38918233-38918255 CTGAGGCATCAGTGCATCAGTGG + Intronic
906955850 1:50372997-50373019 CTAAGGCATGAGTTCTACACTGG + Intergenic
910544601 1:88399558-88399580 CTAAGGCATGAATACAATTTAGG + Intergenic
916491654 1:165307450-165307472 CCAAGGCCACAGTACAACTTGGG + Intronic
920659286 1:207901761-207901783 CCAAGGCAAGAGTACAACAGAGG - Intronic
1067823966 10:49556251-49556273 GTAAGGCAGAAGTCCAACATGGG + Intergenic
1071106962 10:82109195-82109217 CCAAGGAATGAGTAGAACATGGG + Intronic
1071164442 10:82788213-82788235 ATAAGGCATAAATACAACATAGG - Intronic
1076233764 10:128847303-128847325 CTAAGTGGTCAGTACATCATTGG - Intergenic
1079742852 11:24085645-24085667 CTCAGGCATCAGCTTAACATTGG + Intergenic
1082716449 11:56619869-56619891 CTGAGGCATCTGTAGAACAGGGG - Intergenic
1084305349 11:68279111-68279133 CCAAGGCATGATTACAAGATTGG - Intergenic
1085956255 11:81399679-81399701 AAAAGGCATCAGTACGACAGAGG - Intergenic
1095884786 12:47177574-47177596 CTAAGGCATCAGTACAACATAGG - Intronic
1100100819 12:91102388-91102410 CTTAGGCATGAGAATAACATAGG + Intergenic
1100703177 12:97169915-97169937 CTATGGCTCCAGCACAACATGGG - Intergenic
1104790412 12:131478086-131478108 GTAAGGCCTTAGTACAACATTGG - Intergenic
1109341790 13:61071023-61071045 CTAATGCAACTGTACAATATAGG + Intergenic
1117064402 14:51995709-51995731 CTGAGGCATCAGCAAAAAATTGG - Intronic
1120112261 14:80571161-80571183 CTAAGGGACCAGCACAATATAGG - Intronic
1120313280 14:82858932-82858954 TTAAAACATCAGTACATCATAGG + Intergenic
1122918939 14:104871687-104871709 CTTGGGCCTCAGCACAACATAGG - Intronic
1149736474 17:58999189-58999211 CTAAGACAGCAGTAGTACATGGG - Exonic
1156212237 18:34957350-34957372 CTGAGGCATCTGTTCTACATAGG + Intergenic
1160486206 18:79295269-79295291 CTAAAGCATCAGAAATACATTGG + Intronic
1167434354 19:49470453-49470475 CTCAGGCATCAGTCCCCCATAGG - Exonic
938828018 2:135025819-135025841 GCAAGGGTTCAGTACAACATAGG - Intronic
1172253854 20:33499267-33499289 CTAAGGAATGAGAACAAAATTGG - Intronic
1173592028 20:44232146-44232168 CTAAAGCATCAGCACAGCACTGG - Intergenic
1176792914 21:13341566-13341588 CTGCGGCATCCCTACAACATTGG - Intergenic
1178115209 21:29409906-29409928 TTAAGCCATCTTTACAACATGGG + Intronic
1178351969 21:31878378-31878400 GTAAGGAATCAGTAAAACAATGG + Intronic
1178492253 21:33060136-33060158 CCAAAGCATCAGTACCACCTGGG + Intergenic
1182967748 22:34537950-34537972 CTAAGTCCTCACTCCAACATTGG + Intergenic
957606887 3:82411292-82411314 GTAAGCCATCAGGATAACATTGG + Intergenic
964413616 3:156425161-156425183 CTAAGGCCTCAGTTGAACGTAGG - Intronic
970309044 4:14762376-14762398 CTTAGGAATCAGAAAAACATAGG + Intergenic
972427980 4:38952901-38952923 CTAGGGCATCAATACCAAATAGG + Intergenic
973127605 4:46607086-46607108 CTTTGGAATCAGTACAACTTGGG - Intergenic
976350878 4:84058559-84058581 ATAAAGTATCAGTACAACCTTGG - Intergenic
976382075 4:84410943-84410965 CTGAGTCTTCAGTTCAACATGGG + Intergenic
979127308 4:116990611-116990633 CTAAGAAATCAGTATAACAAAGG - Intergenic
979450350 4:120863374-120863396 CTTAGCCATGAGTACAACAATGG + Intronic
989080335 5:37612794-37612816 CTCAGGCATAACTAAAACATGGG - Intronic
990703646 5:58502565-58502587 CTAAGATATCAGTAAAAAATAGG + Intergenic
992548668 5:77841035-77841057 CTTAGGCGTCAGTACACCAAAGG + Intronic
995663436 5:114512442-114512464 CTTAGGCAACAGTAGAAAATAGG + Intergenic
996080009 5:119247352-119247374 TTAAGGCATCAGTGCATCAAGGG - Exonic
997054602 5:130426315-130426337 TCACTGCATCAGTACAACATGGG + Intergenic
998890876 5:146744403-146744425 CTTAGGCTTCAGTGCACCATGGG + Intronic
1002588753 5:180272397-180272419 CAAAGGAATCAGTACAGTATCGG - Intronic
1006684290 6:35819536-35819558 CTCAGGCATCAGGACACCAGGGG + Intronic
1009957796 6:70476811-70476833 ACAAGGCTGCAGTACAACATAGG - Intronic
1012602928 6:101119993-101120015 CAAAGGCAGAAGTGCAACATAGG - Intergenic
1014926465 6:127276866-127276888 CTAAAGCATGAGTACCACCTGGG + Intronic
1016096943 6:140049770-140049792 CTTAGGCATCAGAAAAACAAAGG - Intergenic
1020415912 7:7945613-7945635 CTAAAGCATCAGTACACTGTGGG + Intronic
1022161832 7:27718590-27718612 ATAAGGCATCATTACTGCATGGG + Intergenic
1023391813 7:39718186-39718208 CTAAGGCATCTTTACAAAAATGG - Intergenic
1030585163 7:111409570-111409592 TTAAGACATCAGTATAACCTTGG + Intronic
1031507474 7:122603951-122603973 CTAAGAACTCTGTACAACATGGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1032880388 7:136083854-136083876 ACAAGACATCACTACAACATAGG - Intergenic
1033614761 7:143003558-143003580 CAAAGGCATCTGAGCAACATCGG + Intergenic
1035904489 8:3494282-3494304 CCAAGACATCTGTACAACAATGG + Intronic
1037850533 8:22323951-22323973 CCAAGGCACCAGTAGAATATTGG + Intronic
1040297972 8:46172906-46172928 CTGAGGCTTCAGTACAAAATGGG - Intergenic
1041328017 8:56689708-56689730 CTAAGACATCAGAGAAACATAGG + Intergenic
1041876109 8:62689542-62689564 CTGATACATCAGTACAACTTTGG - Intronic
1044171032 8:89051642-89051664 CTAAGGAATGAGAACAAGATGGG + Intergenic
1050395519 9:5190950-5190972 CAAAGGTTTCAGAACAACATTGG + Intergenic
1050619716 9:7440185-7440207 AAAAGGCATCAGTACAAAAGAGG - Intergenic
1051985448 9:23080689-23080711 CTAAGGCATAAGTATTGCATTGG - Intergenic
1059849026 9:118315971-118315993 CATAGTCATCAGTACTACATTGG + Intergenic
1186140615 X:6567992-6568014 GTGAGGCATCAGGACCACATGGG - Intergenic
1186935576 X:14447321-14447343 CTGAGCCATCAGCTCAACATGGG - Intergenic
1187766062 X:22643673-22643695 CTGAGGCACCAGTTCTACATTGG - Intergenic
1190496620 X:51033254-51033276 CAAAGGCATCAGGTCAACAGAGG - Intergenic
1190509352 X:51160683-51160705 CAAAGGCATCAGGTCAACAGAGG + Intergenic
1192737166 X:73860816-73860838 CTCAGGCATGCCTACAACATTGG + Intergenic
1193302700 X:79909930-79909952 CTTTGGCATCAGTATAATATTGG + Intergenic