ID: 1095885394

View in Genome Browser
Species Human (GRCh38)
Location 12:47183751-47183773
Sequence GATGAGTCCCTGTCCTCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095885394 Original CRISPR GATGAGTCCCTGTCCTCACG TGG (reversed) Intronic
900163276 1:1234637-1234659 GATGGGGCCCTGCCCTCCCGTGG + Exonic
900745134 1:4355865-4355887 GATGAGCCCCTGCCCACACCAGG - Intergenic
901719455 1:11184857-11184879 GATCAGTCCCGCTCCTCACCTGG + Intronic
903005275 1:20294085-20294107 GTTGGGTCTCTGTCCTCAAGAGG + Intronic
904004457 1:27356591-27356613 GATCAGTCTCTGCCCTCAAGAGG + Exonic
904373836 1:30066986-30067008 GATGTGCCTCTGTCCTCAGGTGG - Intergenic
906687320 1:47771108-47771130 GATGGGGTCCTGTCCTCACCTGG + Intronic
907284654 1:53371809-53371831 GATAAGTCCCTGTTCTCATGGGG + Intergenic
914446991 1:147758659-147758681 CAGGAGTCCCTGTCCCCACCCGG - Exonic
916715577 1:167444200-167444222 TCTGAGTCCCTGCCCTCATGGGG + Intronic
921168191 1:212522460-212522482 AAGGAGTCCCTGTTCTCAAGGGG - Intergenic
922757714 1:228105724-228105746 GAGCAGTGCCTGACCTCACGTGG - Intergenic
923717236 1:236435377-236435399 CAGGAGTCCCTGCCCTCAAGGGG - Intronic
1065778236 10:29142649-29142671 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1068046686 10:51895316-51895338 GGTGTGTCCCTTTCCTCAGGGGG + Intronic
1069777726 10:70936544-70936566 GATGAATGCCTTTCCTCATGCGG - Intergenic
1070284231 10:75071743-75071765 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1071893847 10:90042280-90042302 CAGGAGTGCCTGTCCTCACCTGG + Intergenic
1073215204 10:101832511-101832533 GATCAGGCCCTGTTCTCAGGAGG + Intronic
1076352206 10:129825075-129825097 GACCAGCCCCTGTCCTCACGGGG + Intergenic
1076672241 10:132129636-132129658 GATCAGTGCCTCTCATCACGGGG - Intronic
1077112123 11:866480-866502 GAGCAGTCCCTGTCCTCAGCAGG - Intronic
1078100624 11:8328493-8328515 GAGGACTCCCTGTCCTCTTGGGG - Intergenic
1080392882 11:31864726-31864748 AAGGAGTCCCTCTCCTCAAGGGG + Intronic
1080799673 11:35598558-35598580 GAAGAGTCCCTGTGCCCAAGGGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082010554 11:47447335-47447357 GCCAAGTCCCCGTCCTCACGAGG - Intronic
1082129676 11:48472743-48472765 GATGAGTTCCTGTCCTTTGGAGG + Intergenic
1083107604 11:60373650-60373672 CAGGAGTGCCTGTCCTCACCTGG - Intronic
1084460804 11:69295598-69295620 AACGAGTCCCTGTCCCCAAGGGG - Exonic
1085202710 11:74711394-74711416 AAAGAGTCCCTGCCCTCACAGGG + Intronic
1085449859 11:76625259-76625281 GAGGAGGACCTGTCCTCAGGTGG - Intergenic
1087212815 11:95460788-95460810 GCTGTGTCCCTGGCCCCACGAGG - Intergenic
1087935464 11:104028959-104028981 GATTAGTTCCTGTCCTCTGGAGG + Intronic
1090035922 11:123249462-123249484 GCTGACTCCTTGTCCTCATGTGG - Intergenic
1091332746 11:134743488-134743510 GGTGAGAAGCTGTCCTCACGAGG + Intergenic
1095885394 12:47183751-47183773 GATGAGTCCCTGTCCTCACGTGG - Intronic
1096499095 12:52054689-52054711 GATGAGGCCCTGTCCTCCAGTGG + Exonic
1098632318 12:72739158-72739180 GAAAAGTCCCTGCCCTCATGGGG - Intergenic
1101492002 12:105218368-105218390 GCACAGTCCCTGTCCTCATGGGG + Intronic
1104450186 12:128862746-128862768 CAGCAGTCCCTGTCCTCAGGAGG + Intronic
1104613588 12:130250355-130250377 GACAAGTCCCTGTCCTCATGGGG + Intergenic
1113808339 13:113122820-113122842 ACTGTGTCCCTGTCCTCACTGGG - Exonic
1118920613 14:70146316-70146338 GCTGAGTCCCTGTCTTCAAAAGG + Intronic
1121324306 14:93011136-93011158 GATGAGTCCGTGTCACCACAGGG + Intronic
1123694506 15:22868320-22868342 AATGAGTCTCTGTCCTCAAGGGG - Exonic
1127707520 15:61561917-61561939 GATGAGTTCCTGTCCTCTGCAGG - Intergenic
1127902131 15:63348760-63348782 GAGGGGTCCCTATCTTCACGAGG - Intronic
1130130999 15:81142649-81142671 GATGAGTTACTATCCTCATGAGG - Intronic
1131013348 15:89037731-89037753 GATGAGTACCTGTACTGCCGTGG + Intergenic
1132915047 16:2339763-2339785 GATGAAGCCATGTCCTCAGGGGG - Intronic
1134135020 16:11672094-11672116 GAGGAGACCCTGTTCTCAGGGGG - Intronic
1135621858 16:23962636-23962658 GATGTGCCCCTGCCCTTACGGGG - Intronic
1137291037 16:47052079-47052101 AAAGAGTCCCTGTCCTCACTGGG - Intergenic
1138607583 16:58098795-58098817 GATGCGGCCCTGCCCTCCCGGGG + Intergenic
1140698243 16:77556454-77556476 GATGTGGCCTTGTCCTCAAGAGG + Intergenic
1144270890 17:13614630-13614652 GATGTGTCCCTGTCTCCACTAGG - Intergenic
1146619869 17:34389023-34389045 GATCAGTCCCTGCCACCACGGGG - Intergenic
1148793970 17:50188479-50188501 GAAGAGTCCCTGGCCTGACCAGG + Intronic
1159369757 18:67516075-67516097 GCCGAGTCCCTGTCCTCAGGTGG + Intronic
1160409883 18:78668059-78668081 GATGAGAGCCTGTCCTTACACGG - Intergenic
1160518638 18:79491811-79491833 GCTGAGTCCCCGGCCCCACGAGG - Intronic
1160625079 18:80198570-80198592 GCTGTCTCCCTGTCCTCACTGGG - Intronic
1164856434 19:31528213-31528235 GAAGAGACCCTGCCCTCATGAGG + Intergenic
1165334199 19:35157498-35157520 GATGTGTCCCTTTCCTCACCTGG - Exonic
1165406875 19:35636497-35636519 AATGAATCCCTGTCCCCACAAGG - Intronic
1165846257 19:38819608-38819630 CAACAGTCCCTGTCCTCATGGGG + Intronic
1167035515 19:46993044-46993066 CATCTGTCCCTGTCCACACGGGG - Intronic
1167830384 19:52015690-52015712 GATGTGTGTCTGTCCTCAGGAGG - Exonic
925473581 2:4188748-4188770 GATCAGGCCATGTCCTCACATGG - Intergenic
926155121 2:10449075-10449097 GCTGAGTCCCTGGCTTCACAGGG - Intergenic
930608694 2:53518044-53518066 GATGAGTCTCAGTCCTCCCTAGG + Intergenic
930696923 2:54420936-54420958 GATGAGTCCCAGTTCCCTCGAGG - Intergenic
932126959 2:69153204-69153226 GATGAGTCCCTGTCCTGGAGAGG - Intronic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
933754068 2:85623854-85623876 GATTCTTCCCTGTCCTCAGGTGG - Intronic
936736944 2:115456639-115456661 GATGAGTTCCTGTCCTTTGGAGG + Intronic
940312457 2:152292786-152292808 GATGAGTCCCTGTATTCCAGGGG - Intergenic
942227743 2:173831829-173831851 GATGAGTCTCTGTCCTTTCTCGG + Intergenic
945266388 2:207895342-207895364 GATCAGTCCCTGTCCCCAGCAGG + Intronic
947183877 2:227437466-227437488 CTTGAGTCCCTGACCTCAAGTGG + Intergenic
1171345386 20:24461997-24462019 GATTACTCCCTGTCTTCATGGGG + Intergenic
1171363730 20:24609525-24609547 GATGAGTCCCTGGACTCAGCTGG + Intronic
1172514512 20:35523625-35523647 GATGAGTCCCTGATATCACTGGG - Intronic
1175759942 20:61555455-61555477 GATGAGACCCTGTCCTCAGAGGG - Intronic
1180996478 22:19968313-19968335 GAAAGGTCCCTGTCCTCACGGGG + Intronic
1181034039 22:20161455-20161477 TTTGAGCCCCTGTCCTCACCTGG - Intergenic
1181687253 22:24537954-24537976 GAGGTCTCCCTGTCCTCAAGGGG - Intergenic
950716736 3:14853180-14853202 GATGCTTCCTTGTCCTCACAGGG - Intronic
954426272 3:50444802-50444824 GATGAGCCCATGTCCTCTCATGG + Intronic
956833169 3:73073298-73073320 GATGAGGCCCTTACCTCACAGGG + Intergenic
956871460 3:73422118-73422140 GAAAAGTCCCTGCCCTCAAGGGG - Intronic
958108644 3:89110508-89110530 GATGAGTCCCTATTATCACCTGG - Intronic
960415743 3:117383101-117383123 CATGAATGCCTGTCCTCACCTGG - Intergenic
961408729 3:126703399-126703421 GACCATTCCCTGTCCTCCCGGGG + Intergenic
961494167 3:127278694-127278716 GATGACCCCCTGCCCTCAGGTGG - Intergenic
963920372 3:150899521-150899543 GCTGAGTCCCTCTCCTCTCATGG - Intronic
966584519 3:181606722-181606744 GATTAGTTCCTTTCCTCATGGGG + Intergenic
967340413 3:188391095-188391117 GATGAGTCTTTGTACTCATGAGG - Intronic
968870537 4:3239780-3239802 GCTGCCTCCCTGTCCTCACCTGG - Intronic
968908876 4:3466631-3466653 TCTGATTCCCTGTCCTGACGCGG - Intronic
968974990 4:3817412-3817434 CAGGAGTCCCTGTGCTCAGGTGG - Intergenic
971558081 4:28038824-28038846 GTTGAATCCCTGACCTCAAGAGG - Intergenic
973612998 4:52655273-52655295 GGTGAGTCCCTGTCCCCAAGGGG - Intronic
975514975 4:75237094-75237116 GATGTGTCCCTGTGCTGATGAGG - Intergenic
978638881 4:110844626-110844648 GGTGAGTCCCTTTCCTCACTTGG + Intergenic
985608722 5:873834-873856 GATGAGTCTCTGTCCTTCCCAGG - Intronic
990865469 5:60375229-60375251 GATATGTCCCTGTCCTCATAGGG - Intronic
991994186 5:72371074-72371096 GCAGAGTCCCTGCCCTCATGGGG - Intergenic
992624596 5:78625796-78625818 CAAGAGCCCCTGGCCTCACGGGG + Intronic
994140867 5:96339746-96339768 GAAGAGTTCCTGTCCTCAGCAGG - Intergenic
995183721 5:109251184-109251206 GATGAGTCCTTGGCCGCAGGCGG - Intergenic
998175536 5:139899653-139899675 GTCGAGTCCCTGCCCTCACAAGG - Intronic
1000541778 5:162549904-162549926 CAGGAGTGCCTGTCCTCACCTGG - Intergenic
1002166765 5:177352339-177352361 GATGAGTTCCAGTCATCACTGGG - Intergenic
1002442573 5:179272070-179272092 CAGGAGTCCCTGACCACACGGGG + Intronic
1004189482 6:13451399-13451421 GATGGCTCCCTGACCTCACCAGG - Intronic
1006360487 6:33584491-33584513 GGTGGGTCCCTGTCCTCACAGGG - Intergenic
1007857097 6:44869070-44869092 GATGAGACTCTGTGCTCACATGG + Intronic
1007988952 6:46234929-46234951 GGTGAGTCCCTGTGCTGACTAGG + Intronic
1013626526 6:111942883-111942905 GATCAGTCCCAGTCCTAAAGAGG - Intergenic
1017812034 6:157990410-157990432 GGTGAGGCCCTGTCCTCAGGGGG - Intronic
1019260570 7:79693-79715 GCTGGGTCCCTGCCCTCACCGGG + Intergenic
1019636075 7:2076378-2076400 GACCAGCCCCTGTCCTCACAGGG - Intronic
1022480963 7:30742689-30742711 GAAGAGTGCCTGTCCTGATGTGG - Intronic
1026369547 7:69684969-69684991 TATGAGTCCCTGTACACACCAGG - Intronic
1028386199 7:90256207-90256229 GATGAGTTCCTGTCCTTTCCAGG + Intronic
1029159418 7:98541098-98541120 GCTGAGCCCCTGTCCTCCTGGGG + Intergenic
1032906233 7:136370335-136370357 GATGAGTCACTGTCATCATTAGG + Intergenic
1034500663 7:151448553-151448575 GCTGAGTCCCTGCCCTTCCGAGG + Intergenic
1035571356 8:675153-675175 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571362 8:675180-675202 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571368 8:675207-675229 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571381 8:675262-675284 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571394 8:675317-675339 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571407 8:675372-675394 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571427 8:675455-675477 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571440 8:675510-675532 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571453 8:675565-675587 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571466 8:675620-675642 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571479 8:675675-675697 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571492 8:675729-675751 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571498 8:675756-675778 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571525 8:675866-675888 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571552 8:675975-675997 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571567 8:676030-676052 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571573 8:676057-676079 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571579 8:676084-676106 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571585 8:676111-676133 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571620 8:676250-676272 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571626 8:676277-676299 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571646 8:676360-676382 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1035571652 8:676387-676409 GCCGCGTCTCTGTCCTCACGAGG - Intronic
1039707584 8:40023203-40023225 AAGAAGTCCCTCTCCTCACGTGG + Intergenic
1041505560 8:58593862-58593884 GATGTGTGCCTGTCAGCACGTGG - Intronic
1048014262 8:130483574-130483596 GATGAGTCCCTCTCCTTCCTGGG + Intergenic
1049498421 8:142947560-142947582 GATCAGTCCTTGTCCTGAGGTGG - Intergenic
1052036368 9:23685663-23685685 CATGAGTGCCTGTCCTGAGGGGG - Intergenic
1053693194 9:40609294-40609316 GATGAGTTCATGTCCTTACTAGG - Intergenic
1053783555 9:41634358-41634380 TCTTAGTCCTTGTCCTCACGTGG - Intergenic
1054271640 9:63030795-63030817 GATGAGTTCATGTCCTTACTAGG + Intergenic
1054304435 9:63408521-63408543 GATGAGTTCATGTCCTTACTAGG - Intergenic
1054403181 9:64732539-64732561 GATGAGTTCATGTCCTTACTAGG - Intergenic
1054436803 9:65218029-65218051 GATGAGTTCATGTCCTTACTAGG - Intergenic
1054493594 9:65803965-65803987 GATGAGTTCATGTCCTTACTAGG + Intergenic
1060814628 9:126628104-126628126 GATGTGGCACTGTCCTCACCTGG - Intronic
1062744116 9:138200697-138200719 GCTGGGTCCCTGCCCTCACCGGG - Intergenic
1185829301 X:3284365-3284387 TGTGTGTCCCAGTCCTCACGTGG + Exonic
1186814718 X:13225135-13225157 CATGTGTCCCTGTCTTCACATGG + Intergenic
1187469257 X:19553439-19553461 GATGAGTTCCTGCCCTCCTGGGG - Intronic
1188793490 X:34434436-34434458 GATGAGTTCTTGTCCTTTCGAGG - Intergenic
1189120517 X:38389346-38389368 GATGAGGCCCAATCCTCAAGAGG + Intronic
1190248215 X:48704784-48704806 GATTGGTCCCTGCCCTCAAGGGG - Intronic
1192390368 X:70720198-70720220 GATGAGTCCCTGTCCTATGTAGG + Intronic
1193836395 X:86349476-86349498 CAGGAGTGCCTGTCCTCACCTGG + Intronic
1195704332 X:107728061-107728083 GATAAGCCCCTGCCCTCACAAGG - Intronic