ID: 1095886124

View in Genome Browser
Species Human (GRCh38)
Location 12:47190342-47190364
Sequence GGGTTAGAACAGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095886124_1095886135 29 Left 1095886124 12:47190342-47190364 CCAAGTTCCATCTGTTCTAACCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1095886135 12:47190394-47190416 TGGCACCCATGCATTCACTTTGG 0: 1
1: 0
2: 1
3: 12
4: 102
1095886124_1095886126 -5 Left 1095886124 12:47190342-47190364 CCAAGTTCCATCTGTTCTAACCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1095886126 12:47190360-47190382 AACCCACTTCCTCCTTGTCCTGG 0: 1
1: 0
2: 5
3: 28
4: 312
1095886124_1095886131 9 Left 1095886124 12:47190342-47190364 CCAAGTTCCATCTGTTCTAACCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1095886131 12:47190374-47190396 TTGTCCTGGTCTCCAACCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095886124 Original CRISPR GGGTTAGAACAGATGGAACT TGG (reversed) Intronic
900543054 1:3213648-3213670 GGGTAAGAACAGGAGGAGCTTGG - Intronic
901188348 1:7389210-7389232 GGGTTAGGAGGGATGGAGCTGGG - Intronic
902099051 1:13970186-13970208 GGCTGAGAACAGATGGTATTTGG - Intergenic
903834372 1:26193338-26193360 AGGTTAGGACAGATGGAGCTTGG + Intronic
904766462 1:32852508-32852530 AGTTTAGAACAGATGGAGGTGGG - Intronic
904886420 1:33742077-33742099 GGGTTAGGAAAGACAGAACTAGG + Intronic
909764154 1:79333913-79333935 GGGCTAGAACATAAGGTACTTGG + Intergenic
910606606 1:89092163-89092185 TGGTTAGACCAGAGTGAACTTGG - Intergenic
913149044 1:116022094-116022116 GGGTTGGACCAGTTAGAACTAGG + Intronic
913387697 1:118277772-118277794 GGGTTAGAGCAGAGGGAAGAAGG + Intergenic
915584551 1:156837302-156837324 GGTTTAGAGCAGATGATACTTGG - Intronic
920691660 1:208151468-208151490 TGGTGAGAACTGATGGAATTAGG + Intronic
920963108 1:210681493-210681515 GGGTTGGCACAGATGGCCCTGGG - Exonic
921967924 1:221112059-221112081 GGATTAGAACAGATTTATCTTGG + Intergenic
922544965 1:226449802-226449824 GGGATAGACCAGATGGAAAGAGG - Intergenic
1067430811 10:46243319-46243341 AGCTTAGAACAAATGGACCTAGG + Intergenic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1068681812 10:59828143-59828165 TGGTAAGAACATTTGGAACTTGG - Intronic
1070306219 10:75240704-75240726 GCTTTAGAACAGATGGACTTGGG + Intergenic
1074347408 10:112700844-112700866 GTGGTGGAACAGATGAAACTTGG - Intronic
1076842027 10:133050428-133050450 GACTTAGACCAGATTGAACTGGG - Intergenic
1078641214 11:13098441-13098463 GGGTCAGAACAGATGGTAGTGGG + Intergenic
1080419796 11:32099669-32099691 GGATTGAAACAGTTGGAACTGGG - Intronic
1083273730 11:61585409-61585431 GGCTTAGACCAGCTGGAAGTTGG + Intergenic
1083538019 11:63490072-63490094 GGGTGATAACAGATGGTACTGGG - Intronic
1083623583 11:64060603-64060625 GGATTAGAACTGGTGAAACTGGG + Intronic
1084364779 11:68690507-68690529 GGGCTCCAACAGAGGGAACTTGG - Intronic
1084493746 11:69491978-69492000 GGGGTGGAGCAGAGGGAACTGGG + Intergenic
1085052304 11:73386203-73386225 GGGGTAGCAGAGAAGGAACTTGG - Intronic
1085062397 11:73459820-73459842 TGGATAGACCAGATGGAACAGGG - Intronic
1087061979 11:93987728-93987750 GGATTAGAATAGATAGGACTTGG - Intergenic
1089200464 11:116721721-116721743 TGGTTACAGCAGATGGAAATGGG + Intergenic
1089988212 11:122833352-122833374 GGGTTAGAACAGAAGAGGCTGGG + Intergenic
1091389177 12:115340-115362 GGGTTGGAACAGAAGGAAGATGG + Intronic
1093103042 12:15050730-15050752 GTGTTAAAACTCATGGAACTTGG + Intergenic
1094687353 12:32730860-32730882 GAGTTAGAACACATGGTAATGGG + Intronic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1096005418 12:48166511-48166533 GTGTTAGGACTGATAGAACTTGG + Intronic
1098382224 12:69881334-69881356 GGGATAGAAGAAATGGGACTTGG - Intronic
1100736597 12:97541600-97541622 GAGTTAGAAAAGCTGGAACCAGG + Intergenic
1100737545 12:97553774-97553796 GGCTTAGAAGAGATTGGACTTGG - Intergenic
1101190698 12:102329410-102329432 TGCATAGAACAGATGGATCTTGG + Intergenic
1101881947 12:108631677-108631699 GGGTTCCAACAGGTGTAACTTGG - Intronic
1102014092 12:109636528-109636550 GGGTCAGAGCAGATGGCAGTGGG + Intergenic
1103124274 12:118407993-118408015 GGGAGAGAACAGCTTGAACTCGG - Intronic
1104463631 12:128973577-128973599 GGGTTAGAGCAGGAGGAAGTTGG - Intronic
1107239079 13:38210776-38210798 TGGGTAGTACAGATGGAAGTAGG - Intergenic
1109177714 13:59176611-59176633 GGATTGGAATATATGGAACTGGG - Intergenic
1109495257 13:63161954-63161976 GGTATAGAACAGATGTATCTAGG - Intergenic
1110611429 13:77492296-77492318 GGATTAGAATAGAGGGAAATAGG + Intergenic
1112404357 13:99105190-99105212 TGTTTAGACCTGATGGAACTTGG - Intergenic
1114472683 14:22974614-22974636 GGGATAGAAGAGATGGAGCCTGG + Intronic
1115502541 14:34062477-34062499 GGGTTAGAGCAGAGGGGTCTTGG - Intronic
1115795604 14:36931753-36931775 GAGTTAGAATAGATGGGACTTGG + Intronic
1118119517 14:62823200-62823222 AGGTTAGAAAAGTTGGAACAAGG - Intronic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120027108 14:79598889-79598911 GGGTTAGAAGAGGTGGCCCTGGG + Intronic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1126204999 15:46035441-46035463 GGGCTTCAACATATGGAACTGGG - Intergenic
1126378317 15:48019034-48019056 AGGCTAGAAAAGGTGGAACTGGG - Intergenic
1131600406 15:93841968-93841990 AGGTTATAAGAGATGGAATTGGG - Intergenic
1135875672 16:26197892-26197914 GGGTTGGAACAATTAGAACTTGG - Intergenic
1136034566 16:27529346-27529368 GGGTGAGAACTGCTTGAACTGGG + Intronic
1141102238 16:81206340-81206362 GGTTTAGAACAGAAGCAAATGGG - Intergenic
1144106076 17:11986706-11986728 TGGTCAGAACACATGGACCTTGG + Intronic
1144191872 17:12853920-12853942 GGGCCAGAACACATGGAAATGGG - Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1153364326 18:4237095-4237117 GTGTTAGGACAGAGGGAAGTCGG + Intronic
1155055854 18:22182969-22182991 GAGTTAGAAGAGGTGGAAGTTGG - Exonic
1156269711 18:35519641-35519663 GGGGTAGAACAAAGGGAACCAGG - Intergenic
1158506328 18:58049255-58049277 GCATTAGCACAGAAGGAACTGGG + Intronic
1162131673 19:8529923-8529945 GTGATGGAACAGATGGATCTAGG + Intronic
1162131688 19:8530000-8530022 GTGATGGAACAGATGGATCTAGG + Intronic
1162131706 19:8530077-8530099 GTGATGGAACAGATGGATCTAGG + Intronic
926684895 2:15690978-15691000 GGGTCAGAACGGACGGAGCTTGG - Intronic
927975270 2:27333790-27333812 GGGAAAGAAGAGATGGGACTAGG + Intronic
930847351 2:55920083-55920105 AGGTCAGATCAGCTGGAACTGGG - Intronic
931323141 2:61192200-61192222 GGGGTAGAGCAGATGCAACCAGG + Intronic
935377670 2:102416692-102416714 GGGTTAGAACAGCTGGGGCCTGG + Intergenic
935423488 2:102894951-102894973 AGGTCAGACCAGATGGAAGTGGG + Intergenic
935559666 2:104547253-104547275 GGTTAAGAACAGAAGAAACTGGG + Intergenic
937752137 2:125489046-125489068 GGGGTAGAATAGACGGAACTAGG - Intergenic
938659657 2:133472633-133472655 GGGTTAGTACATATGGGTCTCGG - Intronic
938790659 2:134672822-134672844 GAGGTAGAATTGATGGAACTTGG - Intronic
940583073 2:155605915-155605937 GGGCTAGAACACAGGGAAATGGG + Intergenic
942943338 2:181645541-181645563 GGGCCAGAAAAGAAGGAACTTGG + Intronic
942950423 2:181714784-181714806 GGATTAGAACAGATAGGACTGGG + Intergenic
945111863 2:206367634-206367656 GGGTGTGTACAGATGGAATTTGG - Intergenic
1169877036 20:10309359-10309381 GGCTAAGAACAGATGGAGTTTGG - Intergenic
1169930348 20:10826095-10826117 GGGTGACAACAGATGAAACGTGG - Intergenic
1172856932 20:38011989-38012011 AGGCTAGAAAAGATGTAACTTGG + Exonic
1177804714 21:25863307-25863329 GGTTTAAAACAGAAGGAATTTGG - Intergenic
1181901294 22:26158402-26158424 TGGGTAGAGCAGATGGAACCTGG + Intergenic
1182020893 22:27080697-27080719 GAGATAGAAGAGATGGAGCTGGG - Intergenic
1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949419246 3:3848307-3848329 CATTTAGAGCAGATGGAACTAGG + Intronic
949822112 3:8126685-8126707 GGGTTAGAACAGTTGCCAGTGGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951037463 3:17949834-17949856 GGTTTAGAACAGATGAAAGGGGG - Intronic
953108637 3:39910370-39910392 GGGATAGAATAGATGAAATTAGG + Intronic
953708636 3:45250651-45250673 GGGTTAGAACAATTGAAAATTGG - Intergenic
953772829 3:45792075-45792097 AGGTTAGAACAGAAGGGACAAGG + Intronic
954330819 3:49889381-49889403 GGGTTAGAACAGAGAGAACCAGG - Intronic
954660606 3:52224891-52224913 GGGTCAGAACAGATGGAGAGAGG + Intronic
955672811 3:61419386-61419408 GGCTTGGATCATATGGAACTGGG - Intergenic
956114476 3:65904514-65904536 GGGGTAGAACAGTGGGAGCTGGG - Intronic
960368221 3:116801471-116801493 GGATAAGAACACAAGGAACTTGG - Intronic
965364550 3:167782806-167782828 GGATTTGAACATATGGAACTTGG + Intronic
966619981 3:181953070-181953092 GGGTAAGAACAGATAGCACAGGG + Intergenic
967824107 3:193864894-193864916 GTGTTAGAGCACAGGGAACTGGG - Intergenic
971752591 4:30669613-30669635 GGGTTAAAATAGATTGAAGTGGG + Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
978067071 4:104418264-104418286 GAGTTATGACAGATGGCACTAGG - Intergenic
980403153 4:132320162-132320184 GGGGATGAACAGATGGATCTGGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
982322101 4:154087964-154087986 GGGATAGAAAAGATAGAAATAGG - Intergenic
982791510 4:159597504-159597526 GGGTTAGCATAAATTGAACTGGG + Intergenic
985509013 5:301338-301360 GGGGGAGACCAGATGGAATTGGG + Intronic
985739110 5:1604575-1604597 GGGGGAGACCAGATGGAATTGGG - Intergenic
987114313 5:14714150-14714172 GGGAAAGAACAGAGGGAAGTGGG - Intronic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988219028 5:28317338-28317360 GAGTGAGAACATATGGCACTTGG + Intergenic
989111965 5:37915061-37915083 GGGTTAGAACAGATGGCCTCTGG - Intergenic
989117681 5:37971531-37971553 GGGTTGGAACAGGAGGAAGTGGG - Intergenic
990641686 5:57792559-57792581 GGCTGATAACTGATGGAACTGGG + Intergenic
990791712 5:59488082-59488104 GGGTGAAAACTGAGGGAACTAGG - Intronic
994093788 5:95830758-95830780 GGGTTAGAATAGATGGTCTTCGG - Intergenic
994569968 5:101503610-101503632 GGTTTTCAACATATGGAACTTGG + Intergenic
994703826 5:103174256-103174278 GGGTCAGAATTGATGGAACTTGG + Intronic
994967877 5:106697775-106697797 GGGTTTGAATAGATTGAACTTGG - Intergenic
997611051 5:135215997-135216019 GGTTTTGAACAGATGGTTCTGGG - Intronic
999177136 5:149639568-149639590 GCATTAGAACAGAAGGAATTTGG - Intergenic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
1004115064 6:12758781-12758803 AGGAAAGAAGAGATGGAACTAGG + Intronic
1004225169 6:13778400-13778422 TAGTTAGAAAAGATGGAACCAGG + Intergenic
1006083116 6:31578903-31578925 GGGATAGAACAGCTGGAAACTGG - Intergenic
1010477659 6:76308323-76308345 AGGTGAGAACAGAGGGAAATGGG - Intergenic
1011803600 6:91046338-91046360 GGGTTAAAAGAAATGGAATTAGG - Intergenic
1011907302 6:92387807-92387829 GAGATGGAAAAGATGGAACTTGG + Intergenic
1012116500 6:95304941-95304963 GGGATAGAACAGTAGGAACCGGG - Intergenic
1019053459 6:169202251-169202273 GCGTGAGAACAGGTGGACCTGGG + Intergenic
1020062474 7:5162705-5162727 AGGTTAGAAGTGCTGGAACTAGG + Intergenic
1020165677 7:5805994-5806016 AGGTTAGAAGTGCTGGAACTAGG - Intergenic
1020472806 7:8558387-8558409 GAGTTAGAGCAGCTGGAGCTTGG + Intronic
1020857125 7:13443056-13443078 GTGTTAGAAGAGAAGGAGCTTGG - Intergenic
1022973246 7:35536111-35536133 GGATTAGAAGAGATGGTACTTGG - Intergenic
1023176127 7:37437336-37437358 AGGTTAGTTCAAATGGAACTGGG + Intronic
1023516937 7:41010555-41010577 TGGCTGGAACAGAGGGAACTTGG + Intergenic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1025265644 7:57454620-57454642 GGGTTAGAATGGATGGGAATTGG + Intronic
1025719055 7:63992663-63992685 GAGTTAGAATAGATGGGAATTGG + Intergenic
1025747201 7:64253503-64253525 GAGTTAGAATAGATGGGAATTGG + Intronic
1025985873 7:66451337-66451359 AAGTTGGAACAAATGGAACTTGG + Intergenic
1028826980 7:95285079-95285101 AGGTTAGAGCACATGGAGCTAGG - Intronic
1031162770 7:118188356-118188378 GGGGTAGAACAAGTGGTACTAGG + Exonic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034073875 7:148213600-148213622 GGGTGAGAAGAGGTGGACCTGGG - Intronic
1034736901 7:153437791-153437813 GGGTTAGAACATGAGGCACTTGG - Intergenic
1035932421 8:3794909-3794931 AGGTTAGAAAAGATGAAAATGGG - Intronic
1036832304 8:12030436-12030458 TGGTTAGAACAGAGGGAAGTAGG - Intergenic
1041188667 8:55329701-55329723 GCCTTATAACATATGGAACTTGG - Intronic
1043549491 8:81353950-81353972 GGGTTAGAAAAGAGGGAAAGAGG - Intergenic
1043581095 8:81716219-81716241 GTGTTAGAACACATTGAACATGG + Intronic
1043851149 8:85218480-85218502 TGGTTTGAACAAATGGACCTAGG - Intronic
1044097809 8:88089693-88089715 GGGTTAGAAAAGAAAGCACTAGG + Intronic
1046174583 8:110558849-110558871 GGGATAGTACAGATGGAAATGGG - Intergenic
1049205400 8:141361253-141361275 GGGACAGAACAGAGGGAACGAGG + Intronic
1049645794 8:143735096-143735118 GGGAAAGAACAAATGAAACTGGG - Intergenic
1050111367 9:2219962-2219984 GGGTTAGAACATGTGGTATTTGG + Intergenic
1050474941 9:6031378-6031400 GGGTTGGAAGATATGGAACCAGG - Intergenic
1056950907 9:91039986-91040008 CGGTCAGAACAGATGGAGGTGGG + Intergenic
1058078403 9:100674225-100674247 GGGTGAAAACAGATGGAAAGGGG + Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188872488 X:35390065-35390087 GGGCTAGAACAAAGGGAACAAGG + Intergenic
1189404015 X:40701866-40701888 GGGGTACAACATATGGATCTTGG - Intronic
1191712161 X:64161566-64161588 GGATAAGGACAGATGAAACTGGG + Intergenic
1195964397 X:110417139-110417161 GGGTAAGGATAGATGGCACTAGG - Intronic
1196378902 X:115067984-115068006 GTTTTAGAACAGAGGAAACTGGG + Intergenic
1197731912 X:129818004-129818026 GGGCTTCAACATATGGAACTGGG - Intronic
1199376595 X:147118917-147118939 GAATGAGATCAGATGGAACTTGG + Intergenic