ID: 1095888711

View in Genome Browser
Species Human (GRCh38)
Location 12:47215638-47215660
Sequence TATCTTGCTCTGCCACATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095888707_1095888711 23 Left 1095888707 12:47215592-47215614 CCTGCTGGTTTCAAGTGGAACAC 0: 1
1: 0
2: 0
3: 9
4: 149
Right 1095888711 12:47215638-47215660 TATCTTGCTCTGCCACATACTGG 0: 1
1: 0
2: 2
3: 14
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095888711 Original CRISPR TATCTTGCTCTGCCACATAC TGG Intronic
901002794 1:6156918-6156940 ATCCTGGCTCTGCCACATACCGG + Intronic
902069980 1:13726015-13726037 TACCTAGCTCTGCCACCTGCTGG + Intronic
903315291 1:22499046-22499068 TCTCTGGCTCAGCCACTTACAGG + Intronic
905916396 1:41687465-41687487 CATCATGCTCTGCCACATGCAGG + Intronic
907490214 1:54804518-54804540 AATCTGGCTCTGCCACTTCCTGG - Intergenic
909836315 1:80259941-80259963 TCTCTGCCTCTGTCACATACTGG - Intergenic
910608131 1:89109700-89109722 TCTCTTGCTCTGCCATTAACTGG + Exonic
912035122 1:105302446-105302468 CATCTTGCTCTGCCTCCTCCAGG + Intergenic
915815844 1:158963577-158963599 GCTCTTGCTCTGCCATATGCAGG - Intronic
916015144 1:160742999-160743021 TTTCTCCCTCTGCCACATGCTGG + Intronic
918128353 1:181604009-181604031 TGTCTAGCTCTGCCACCCACAGG - Intronic
918169496 1:181982898-181982920 GATCTTGCTCTGCTTCATTCAGG + Intergenic
919877917 1:201884065-201884087 AGTCCTGCTCTGCCACTTACTGG - Exonic
919930208 1:202216349-202216371 TTTCCAGCTCTGCCACTTACTGG - Intronic
922236288 1:223725061-223725083 CCTCTTATTCTGCCACATACTGG + Intronic
922663210 1:227447876-227447898 TTTCCTGCTCTGCCACCTCCCGG + Intergenic
922852783 1:228747937-228747959 ATTCTGGCTCTGCCACTTACTGG + Intergenic
923346992 1:233063830-233063852 TATCTTTCTCTGCTGCATTCTGG + Intronic
923893334 1:238239506-238239528 TATCTAGCTCTCCCACAGAAAGG + Intergenic
924263723 1:242258699-242258721 TATCTTGCTTTGACATATTCTGG + Intronic
924643022 1:245851480-245851502 TCTCTTGCTCTGTCTCCTACCGG + Intronic
1065485680 10:26234425-26234447 AATCTTGCTCTGCCATTGACTGG - Intronic
1066721077 10:38339771-38339793 TATCTTGCTTTGACATATTCTGG - Intergenic
1067956855 10:50801101-50801123 TAGCTTGCTCTGCCATATGAAGG + Exonic
1068980240 10:63055145-63055167 TTTCTTGCTCTGCCACTTGGTGG + Intergenic
1069526674 10:69178358-69178380 TATCTGACTCTACCACTTACTGG + Intergenic
1070807979 10:79281837-79281859 TATCTTCCTCTGCCCTTTACTGG - Intronic
1071940328 10:90584473-90584495 AATCTGACTCTGCAACATACTGG - Intergenic
1072461879 10:95626412-95626434 TACCTAATTCTGCCACATACTGG - Intronic
1073457615 10:103647102-103647124 TATCTTGGCCTGCCACAGCCAGG - Intronic
1074026321 10:109639698-109639720 TATCATGCTCTGTCATATTCTGG - Intergenic
1074369546 10:112888717-112888739 TATCTTACTCTGTTACAGACTGG + Intergenic
1077592538 11:3503807-3503829 CATCTTTCTCTCCCACATGCTGG - Intergenic
1079339281 11:19598694-19598716 TCCCTAGCTCTGCCACATATGGG - Intronic
1079635215 11:22729474-22729496 TAACTTCCTATGCCATATACAGG + Intronic
1079678991 11:23268788-23268810 AATCCTGCTGTGCCACTTACTGG - Intergenic
1081292220 11:41340634-41340656 TATCTTCCTCTGCCAGTTATTGG + Intronic
1081988873 11:47326968-47326990 TATCTTTCCCTTCCACATCCCGG - Intronic
1083562465 11:63683979-63684001 GGTCTTGCTCTGTCACAGACTGG + Intronic
1084248374 11:67876531-67876553 CATCTTTCTCTCCCACATGCTGG - Intergenic
1084824447 11:71718950-71718972 CATCTTTCTCTCCCACATGCTGG + Intergenic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1085632666 11:78132161-78132183 AATCTGGCTCTGCTGCATACTGG - Intronic
1087146709 11:94820425-94820447 TATCTTGCACTGCTACTTGCTGG + Intronic
1092418657 12:8311928-8311950 CATCTTTCTCTCCCACATGCTGG - Intergenic
1092470062 12:8770084-8770106 TATCTTGGCCTCCCACATGCAGG + Intronic
1093684294 12:22038911-22038933 TAACATGCTCTCCCACATGCTGG + Intergenic
1095888711 12:47215638-47215660 TATCTTGCTCTGCCACATACTGG + Intronic
1097559164 12:61180466-61180488 TCTCTAGCTCTGCCCCAAACTGG - Intergenic
1099124193 12:78731894-78731916 AATCTTGCTCTGGCACTTACTGG - Intergenic
1102788100 12:115620573-115620595 GATCTGGGTCTGCCTCATACCGG - Intergenic
1105772652 13:23627554-23627576 AAGCGTGCTCTGCCACATAGAGG - Intronic
1108544279 13:51475879-51475901 TCTCAAGCTCTGCTACATACTGG - Intergenic
1109496994 13:63185256-63185278 TATCTTTATGTGCCAGATACAGG - Intergenic
1110664442 13:78100310-78100332 TTCCTTGCTCTGCCACTTGCTGG + Intergenic
1114083579 14:19220843-19220865 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1117777109 14:59194077-59194099 TAACCTGGTCTGCCACTTACAGG - Intronic
1117963849 14:61187901-61187923 TATCCTTCTCTGGCACATAGTGG + Intronic
1118672559 14:68145348-68145370 TATCTTGTTCTGCCACCTACGGG + Intronic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1120936474 14:89900543-89900565 TGTCTTGCCCTGTCACATTCAGG + Intronic
1121343401 14:93117975-93117997 CATTTTCCTCTGCCACACACTGG - Intergenic
1122021006 14:98837910-98837932 CCTCTTACTCTCCCACATACAGG + Intergenic
1202895190 14_GL000194v1_random:2612-2634 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1126696157 15:51327519-51327541 AATCTTGCTCTGTCATATAGTGG + Intronic
1126842305 15:52729037-52729059 TATCTTGCACTGCCTCAAACCGG + Intergenic
1127667820 15:61166104-61166126 TACATTTCTCTTCCACATACTGG - Intronic
1129345840 15:74918025-74918047 TGTCTTGCTCTGACACAGGCTGG - Intergenic
1133649177 16:7794269-7794291 TATCTTGCTCTAGTACTTACTGG + Intergenic
1133711205 16:8402916-8402938 TTCCTCGCTCTGCCACTTACTGG + Intergenic
1134080142 16:11319359-11319381 ATTCTTGCTCTGCCACTTAATGG + Intronic
1134327279 16:13218543-13218565 TTTCTTGCTCTGCCACTTATTGG + Intronic
1134740239 16:16536528-16536550 ATTCTGGTTCTGCCACATACTGG + Intergenic
1134927262 16:18175633-18175655 ATTCTGGTTCTGCCACATACTGG - Intergenic
1139802008 16:69530445-69530467 CATCTAGGTCTGCCACAAACAGG - Intergenic
1141082205 16:81062085-81062107 TATCTTCCTCGGCCAGATGCAGG + Exonic
1141613004 16:85194073-85194095 AGTCGAGCTCTGCCACATACTGG - Intergenic
1144249303 17:13399630-13399652 AATCTGGGTCTGCCACTTACTGG - Intergenic
1149074118 17:52577056-52577078 TACCTTGCTCTCTCAAATACTGG + Intergenic
1151404243 17:73876447-73876469 TATCTTGCCCTGCCAGGTGCTGG + Intergenic
1152979784 18:266268-266290 TTCCTTGCTCTGCCACTAACAGG + Intronic
1154500258 18:14992505-14992527 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1157229196 18:45898257-45898279 TTTCTGGCTGTGCCACTTACGGG + Intronic
1157910737 18:51615371-51615393 TACTTTGCTCACCCACATACAGG - Intergenic
1158505974 18:58045617-58045639 TATGTTGCTCTGCCAAAAAGGGG + Intronic
1158652903 18:59303582-59303604 AATCTTGCTCTGCCATTTACTGG + Intronic
1159823172 18:73172664-73172686 TATCTTGTTGTGGAACATACAGG + Intronic
1162301372 19:9847009-9847031 CCTCTTGCTCTGACACAAACGGG - Intronic
1164635812 19:29790858-29790880 TACCATGCCCTGCCACATTCCGG + Intergenic
1165565765 19:36726429-36726451 CATTTTGCTGTGCCACATAGGGG + Intronic
1166648772 19:44553996-44554018 TATCTGGATCTGCCACATTAAGG + Intergenic
1167053308 19:47093455-47093477 CATCTTTCTCTGAGACATACAGG + Intronic
1167855709 19:52237954-52237976 GATCTTGCTCTGCCACCCAGTGG + Intergenic
928485577 2:31728212-31728234 TATCTTGCTCTGCCTCCTCAAGG - Intergenic
930102806 2:47616208-47616230 TCTCCTGCCCTGCCACTTACAGG + Intergenic
932193447 2:69761747-69761769 CATCTTGCTCTGTCACAGACGGG - Intronic
935100736 2:99993070-99993092 TCTGTTGCTCTGCCACCTATAGG - Intronic
936133964 2:109873319-109873341 AATCTTGCTCTGTCACATAGTGG + Intergenic
936210733 2:110498166-110498188 AATCTTGCTCTGTCACATAGTGG - Intergenic
937161424 2:119766065-119766087 TATCTTGCTCTCCGAAACACTGG - Intronic
938493009 2:131775790-131775812 TGTCTTCCTCTGGCAGATACAGG - Intergenic
939179355 2:138785780-138785802 AATCTTGATCTGCCACAATCTGG - Intergenic
939683083 2:145162659-145162681 CATCTTTCTCTGTCACATCCTGG + Intergenic
941746550 2:169092932-169092954 AATCTAGCTCTTCCACTTACTGG - Intronic
942377294 2:175350712-175350734 TATATTGCTCTGCTAAAGACTGG + Intergenic
944924064 2:204445238-204445260 TATCCTTCTGTGCCTCATACTGG - Intergenic
945753057 2:213812337-213812359 TAGCTTCCTCTGCCACACTCTGG - Intronic
946749061 2:222874643-222874665 TCTCTTGCTCTGTCACATGTTGG - Intronic
946921869 2:224588588-224588610 TATATTGCTCTTTCACAGACTGG - Intergenic
1168957594 20:1845438-1845460 AATCTAGGTCTGCCACTTACTGG + Intergenic
1169355006 20:4898506-4898528 TCTCTTGCTCTGTCAGAGACAGG - Intronic
1169954344 20:11084630-11084652 TGTCTTGCTCTGTCACAGGCTGG - Intergenic
1171390696 20:24799903-24799925 TGTCTTGCTGCCCCACATACTGG + Intergenic
1173232013 20:41205755-41205777 TAGCTTGCTGGGCCACAAACTGG - Intronic
1175061896 20:56251140-56251162 TATCTTGCACTAGCATATACTGG + Intergenic
1176614892 21:9018599-9018621 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1176710318 21:10145272-10145294 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1177369433 21:20182247-20182269 TATCTTGTTCTGTCAGAGACAGG - Intergenic
1178369567 21:32016352-32016374 CATCTTGCTCCCCCACATTCTGG + Intronic
1178434915 21:32549596-32549618 TTTCTGGCTCTGCCACATACTGG + Intergenic
1179134733 21:38669494-38669516 TATCTGGGTCTGCCACAATCTGG + Intergenic
1179634323 21:42697686-42697708 TCTCTTGCTCTGCCTCATGAGGG - Intronic
1180294397 22:10872424-10872446 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1180497203 22:15901838-15901860 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1181791720 22:25272623-25272645 AATCTGGTTCTGCCACACACTGG - Intergenic
1181827357 22:25528426-25528448 AATCTGGTTCTGCCACACACTGG - Intergenic
1182747263 22:32615543-32615565 CATCCAGCTCTGCCACATTCTGG + Intronic
1182758101 22:32697316-32697338 AATCCTGCTCTGCCATTTACTGG + Intronic
1183037961 22:35154413-35154435 TCTCTGGCTCTGCCACTCACTGG - Intergenic
1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG + Intronic
949408597 3:3740401-3740423 GTTCCTGCTCTGCCACTTACTGG - Intronic
951740456 3:25916460-25916482 TTTCTTGTTCTACCACATTCTGG - Intergenic
952775184 3:37039078-37039100 TATCTTTCTGTGCTACATTCTGG + Intronic
955764855 3:62332161-62332183 TACCTTACTCTGGCATATACAGG + Intronic
957923268 3:86774284-86774306 GATCTTTCTCTGCCACCTAGTGG - Intergenic
958156590 3:89762607-89762629 TCTCTGCCTCTCCCACATACTGG + Intergenic
959754002 3:109875023-109875045 TCTCTTCCTCTCACACATACTGG - Intergenic
960675671 3:120192639-120192661 TATCTTGTTCTGCCTCACACTGG + Intronic
961896334 3:130171154-130171176 CATCTTTCTCTCCCACATGCCGG - Intergenic
962265457 3:133941449-133941471 GTCCCTGCTCTGCCACATACTGG - Intronic
962272074 3:133984622-133984644 TTGCTTGCTCTGTCACATGCTGG - Intronic
964955719 3:162353568-162353590 TATCTAGCTGTCCCACAGACAGG + Intergenic
966851155 3:184165862-184165884 TTCCTGGCTCTGCCACTTACTGG + Intronic
969078671 4:4601325-4601347 TACCTTGATCTGCCAGATGCAGG - Intergenic
969906162 4:10397658-10397680 TATCTTCCTCTGGAACATAAAGG - Intergenic
970412910 4:15827172-15827194 CTTCTTGCTTTGCCACTTACTGG - Intronic
970787699 4:19819378-19819400 TTTCTAGCTCTCCCACATAAAGG + Intergenic
970839778 4:20453903-20453925 CATCTGGCTCTGCCACTTTCTGG - Intronic
971155628 4:24078648-24078670 TGTTTTGCTCTGCCAAATTCTGG - Intergenic
971604030 4:28634139-28634161 TATATTGCACTGCCTCATATTGG - Intergenic
971646425 4:29211385-29211407 ATTATTGCTCTGCCACTTACTGG + Intergenic
974875587 4:67700033-67700055 TAACTAGCTCTGCCACTTAATGG + Intronic
974881258 4:67760047-67760069 GATCTTGCTCTGTCTCAGACTGG - Intergenic
974929354 4:68344260-68344282 TATCTTTATCTGCCAGATTCTGG + Intronic
975717207 4:77216608-77216630 TATCTTCCTCCCTCACATACAGG + Intronic
980069958 4:128233729-128233751 TTTCTGGCTCTGCCACTCACTGG - Intergenic
983714211 4:170757064-170757086 TGTCTGCCTCTGTCACATACTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985817501 5:2137577-2137599 TTTCTTGCTCTGTCACAGAGTGG + Intergenic
987249157 5:16080863-16080885 AATCTTGATCAGCCACATTCAGG + Intronic
987263888 5:16231400-16231422 TCTCTCGTTCTGCCACTTACTGG + Intergenic
988304707 5:29480079-29480101 TATCTGCCTCTCTCACATACAGG - Intergenic
991025873 5:62029017-62029039 TCTCTTGCTCTGGCAGATGCAGG - Intergenic
991497540 5:67242287-67242309 TATATGCCTCTGCCACATCCTGG - Intergenic
992160777 5:73999061-73999083 ATTCTGGCTCTGCCACTTACTGG - Intergenic
993852667 5:93030767-93030789 TATTTTGCTAAGCCACATGCTGG - Intergenic
996444657 5:123532818-123532840 TATATTTCTTTTCCACATACGGG - Intronic
996562135 5:124842641-124842663 TCTCTTGCCCTGAAACATACAGG - Intergenic
996689809 5:126328220-126328242 AATCTTGCTTTGCCACATTGTGG + Intergenic
998954442 5:147424359-147424381 TACCTGGCTGTGCCACTTACAGG + Intronic
999856940 5:155605461-155605483 AGTCTTGCTCTGCCACTTGCTGG - Intergenic
1002689586 5:181041054-181041076 TCTCTTGCTCTCCCAAACACAGG - Intronic
1003778151 6:9392434-9392456 AATCTTGCACTGCCATAGACAGG - Intergenic
1003778367 6:9394975-9394997 TATCTAGCTCTCCCATAGACAGG + Intergenic
1007760448 6:44130233-44130255 TATCTGGGTCTACCACAGACTGG + Intronic
1009024406 6:57981459-57981481 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009199988 6:60732945-60732967 TTTCTTGCTCTGCTTCTTACTGG + Intergenic
1009770644 6:68139420-68139442 AATTTTCCTCTGCCTCATACAGG - Intergenic
1009994767 6:70885862-70885884 GGTCCTGCTCTGACACATACAGG - Intronic
1011115899 6:83891404-83891426 TGTATTTCTCTGCCACATCCAGG + Intronic
1012679578 6:102162480-102162502 TATCTAGCTTTGTGACATACAGG - Intergenic
1012735336 6:102932437-102932459 TATCTTCCTCTTTCACTTACAGG + Intergenic
1015232426 6:130931022-130931044 TGTCTTTCTCAGCCACATTCTGG - Intronic
1016949864 6:149568855-149568877 TATCTCGCTCTGTCTCACACAGG + Intronic
1016989473 6:149919405-149919427 TTACTTGCTCTGCCACATCCTGG + Intronic
1020334209 7:7049322-7049344 TATCTGGCTCTGTCACCTGCAGG + Intergenic
1022020930 7:26398761-26398783 TATCAGGCTCTGCCACACTCGGG - Intergenic
1022268675 7:28784632-28784654 AATCTTGCTTTCCCACACACTGG - Intronic
1024133070 7:46376252-46376274 TATCTTGGTCTGCCTTGTACCGG + Intergenic
1025162561 7:56675644-56675666 AATCTTGCTCTGCCTCAGAAAGG - Intergenic
1026403220 7:70037732-70037754 TACCCTGCTCTGCCACTTCCTGG + Intronic
1026503199 7:70960242-70960264 TATTTGGTTCTGCCACATCCTGG - Intergenic
1028438104 7:90828809-90828831 AAACTCGCTCTGCCACATACAGG - Intronic
1028536275 7:91891340-91891362 TATTTTGCTGAGCCTCATACTGG - Intergenic
1029302817 7:99598406-99598428 CACCTTGCTCTCCCCCATACTGG - Intronic
1029895775 7:103982239-103982261 TATCTTGCTCTGCCATTTATTGG - Intronic
1030769113 7:113451358-113451380 TATCTTACTCTCCCACATCCTGG - Intergenic
1032670187 7:134075290-134075312 TATCTTGCTCTCCCTCTTCCAGG + Intergenic
1036369593 8:8151297-8151319 CATCTTTCTCTCCCACATGCTGG + Intergenic
1036881295 8:12514347-12514369 CATCTTTCTCTCCCACATGCTGG - Intergenic
1037192580 8:16144592-16144614 TATTTTGCTCTGCTACTTACTGG + Intronic
1037489645 8:19386084-19386106 TGTCCTTCTCTGCCACACACCGG - Intronic
1037914339 8:22763499-22763521 AATCTTGCACTGCCACTTCCCGG + Intronic
1039096775 8:33895393-33895415 AATCTGGCTGTGCCACTTACTGG + Intergenic
1042969766 8:74395335-74395357 TATCCACCTCTGACACATACTGG - Intronic
1045056516 8:98372738-98372760 TATCCTGCTCTGCCTCCTCCTGG - Intergenic
1048267481 8:133000239-133000261 TATCATGCTATGGCACACACAGG + Intronic
1050529740 9:6578148-6578170 GATCTTGCTCTGTCACAGGCTGG + Intronic
1051995055 9:23204919-23204941 GTTCTTGCTCTGTCACACACAGG - Intergenic
1052590198 9:30482080-30482102 TGTGTTTCTCTGCCACATATTGG - Intergenic
1052976628 9:34415725-34415747 TAATTTGCTCTGCCTCATCCAGG - Intronic
1053647293 9:40130970-40130992 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1053758433 9:41332873-41332895 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1054328293 9:63728926-63728948 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1054537286 9:66245200-66245222 TGTCTTCCTCTGGCAGATACAGG + Intergenic
1057580383 9:96282024-96282046 TATATTGTTCTGCCACAAAGAGG + Intronic
1061190573 9:129080543-129080565 TATTTCCCTCTGCCCCATACTGG - Intergenic
1061930831 9:133832285-133832307 AATCCTTCTCTGCCACATCCAGG - Intronic
1202795082 9_KI270719v1_random:114267-114289 TGTCTTCCTCTGGCAGATACAGG - Intergenic
1186404026 X:9285856-9285878 TATCCTGCCCTGGCAAATACAGG - Intergenic
1187941894 X:24390701-24390723 TTGCTGGCTCTGCCACTTACTGG + Intergenic
1187988253 X:24838814-24838836 TATCTGGTGCTGCCACCTACAGG - Intronic
1188690244 X:33120460-33120482 TATCTTGCTTTGCTATAAACAGG - Intronic
1195705351 X:107734311-107734333 TCTCTTGCTCTGAAAAATACTGG + Intronic
1201321203 Y:12700115-12700137 TTCTTTTCTCTGCCACATACAGG - Intergenic
1201849320 Y:18460605-18460627 GATCTTGCTCTGCCACCCAGTGG - Intergenic
1201883998 Y:18859770-18859792 GATCTTGCTCTGCCACCCAGTGG + Intergenic