ID: 1095888719

View in Genome Browser
Species Human (GRCh38)
Location 12:47215684-47215706
Sequence GCCTGTGGTTTCCTGTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095888712_1095888719 11 Left 1095888712 12:47215650-47215672 CCACATACTGGATCTAGCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1095888719 12:47215684-47215706 GCCTGTGGTTTCCTGTAGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095888719 Original CRISPR GCCTGTGGTTTCCTGTAGTG TGG Intronic