ID: 1095890678

View in Genome Browser
Species Human (GRCh38)
Location 12:47233148-47233170
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095890678_1095890686 23 Left 1095890678 12:47233148-47233170 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1095890686 12:47233194-47233216 GCCGCGCCCACCACAATTTTTGG 0: 1
1: 0
2: 0
3: 2
4: 35
1095890678_1095890684 -8 Left 1095890678 12:47233148-47233170 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 1095890684 12:47233163-47233185 TTCCAAAGTGCTGGGTTTGCAGG 0: 1
1: 339
2: 17136
3: 314030
4: 261311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095890678 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr