ID: 1095891267

View in Genome Browser
Species Human (GRCh38)
Location 12:47236382-47236404
Sequence TCCAATCCATGTTCATAAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095891267_1095891268 7 Left 1095891267 12:47236382-47236404 CCTCTTTATGAACATGGATTGGA 0: 1
1: 0
2: 2
3: 10
4: 141
Right 1095891268 12:47236412-47236434 GACACTTCCTTTCCATTGCTTGG 0: 1
1: 0
2: 1
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095891267 Original CRISPR TCCAATCCATGTTCATAAAG AGG (reversed) Exonic
903015093 1:20356360-20356382 GCAAATTCATGTTCATGAAGAGG - Intergenic
903883331 1:26527225-26527247 TACAATACATGCTCAGAAAGAGG + Intergenic
906084634 1:43120704-43120726 TCCAATCCATGTTCATAGATTGG - Intergenic
908654546 1:66373909-66373931 TCCAAAACTGGTTCATAAAGGGG - Exonic
909967414 1:81932045-81932067 TCAAATAAATGTTAATAAAGTGG - Intronic
910513433 1:88032726-88032748 TCCAATTCATGATCATAAGATGG - Intergenic
910925570 1:92394708-92394730 CACAATCCATGTTCATGAATTGG + Exonic
912484518 1:110014821-110014843 ACCCATCCATGTTCACACAGCGG - Exonic
915383602 1:155468404-155468426 TCCAGTCCATATTCAAGAAGAGG + Intronic
919400160 1:197104949-197104971 TCCAATCTATGTTCAGAAAATGG - Exonic
921472537 1:215567039-215567061 CCCAATCCATGTTGACAAAGTGG + Intergenic
922410070 1:225364864-225364886 TCCAATTCCTGTTCTTAAAAAGG + Intronic
922905048 1:229167975-229167997 TACATTCCCTGTTCATTAAGTGG + Intergenic
924069250 1:240258947-240258969 TAGAATCCACATTCATAAAGGGG - Intronic
1063550340 10:7026698-7026720 TCCAATACATGTTCATGGTGAGG - Intergenic
1063854854 10:10237929-10237951 TGCAAGACATGTTCATAGAGAGG + Intergenic
1065054196 10:21827068-21827090 TCCAATCCATGAACATAAGACGG + Intronic
1069603954 10:69728328-69728350 TCCAGTCCTGGTTCTTAAAGAGG + Intergenic
1076760357 10:132602088-132602110 TCCATTCCATGTTCACAAACTGG - Intronic
1081123578 11:39295712-39295734 TCCAATCCAAAAACATAAAGTGG + Intergenic
1085461936 11:76699388-76699410 CCCAAGCCATGTCCATCAAGAGG - Intergenic
1087986008 11:104680649-104680671 TCCAACCCATGATCACAATGAGG + Intergenic
1090762829 11:129852154-129852176 TCCAAGCCATAAACATAAAGGGG - Intronic
1094082279 12:26550963-26550985 TCCAATCAATTTTCATCAAGTGG + Intronic
1094278787 12:28710858-28710880 ACCAAGCCATCTTCAGAAAGAGG + Intergenic
1095891267 12:47236382-47236404 TCCAATCCATGTTCATAAAGAGG - Exonic
1097059502 12:56272111-56272133 TCAATTCCCTGTTCAAAAAGAGG + Exonic
1097453830 12:59770623-59770645 TCCAATATAGGTTCATCAAGAGG - Intronic
1098670016 12:73215982-73216004 TCCAATCAAAATACATAAAGTGG - Intergenic
1101353112 12:103951301-103951323 TCCAAACCATATTCATGAAATGG + Exonic
1103022825 12:117550083-117550105 TCTTATCTATGTTCAGAAAGAGG - Intronic
1104497068 12:129250801-129250823 ACCTATCCATGCTCATGAAGTGG + Intronic
1106837223 13:33647660-33647682 TTGAATCCCTGTTCATAATGTGG + Intergenic
1107877001 13:44799758-44799780 TGCAACCCATGTTCACAAAATGG + Intergenic
1108194413 13:47978036-47978058 TCCATTCCATGCTCATAGATAGG + Intronic
1109329592 13:60911875-60911897 TCCATAACATGTTCATAAATCGG - Intergenic
1109860714 13:68194405-68194427 TGCAATCCATGATCAAAAGGTGG + Intergenic
1114543128 14:23478180-23478202 TACAATACATGTGCAAAAAGGGG - Exonic
1115167678 14:30467415-30467437 TACATTCCATGTTCATAAACTGG + Intergenic
1117107792 14:52416166-52416188 TCTAATCTAGCTTCATAAAGTGG - Intergenic
1117527117 14:56619978-56620000 TTCCATCCATGTTCCTAAAAAGG - Intronic
1118682203 14:68254072-68254094 TCCTTTCCAAGTTCCTAAAGAGG - Intronic
1123218303 14:106832252-106832274 CCCCATCCATGCTCATAAAATGG - Intergenic
1138402788 16:56761201-56761223 TCCAATCCCTATTGATAAAACGG - Intronic
1141119972 16:81346065-81346087 TCCAAAACATGTTCAGATAGAGG - Intronic
1142687411 17:1585713-1585735 TCCAAACAATTTCCATAAAGAGG + Intronic
1144133197 17:12267742-12267764 TCCAAAGCATGACCATAAAGTGG + Intergenic
1155809489 18:30214049-30214071 TCCAATCCAGTTTCAAGAAGAGG - Intergenic
1167977668 19:53243650-53243672 TCCGATCCCTGTTCTAAAAGGGG - Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
927006694 2:18857935-18857957 ACCATTCCATGTTCATAAATAGG - Intergenic
927061166 2:19422106-19422128 TCAACTCCATTTGCATAAAGTGG + Intergenic
928049515 2:27975537-27975559 TTCAAACCATGTTCAAAAATTGG + Intronic
928249880 2:29666267-29666289 TTCAATCCCTGTTAATATAGTGG - Intronic
929440138 2:41959301-41959323 TCCAATGCAGGTTGATGAAGGGG - Intergenic
930230308 2:48836284-48836306 TATATTCCATGTTCATCAAGTGG - Intergenic
930354498 2:50300641-50300663 TCTAAGCCATGCTCTTAAAGGGG + Intronic
930993718 2:57690619-57690641 AACAATCCATGTTCATGAATTGG + Intergenic
932437773 2:71712877-71712899 TCCCATCCATGTTCATGGACAGG + Intergenic
933587747 2:84198396-84198418 TCCAATCCATATTCAAGGAGGGG + Intergenic
933884243 2:86703068-86703090 TCAAATCCTTGTTTAAAAAGAGG + Intronic
936184799 2:110294589-110294611 TCAAATCTTTGTTCATAAATTGG + Intergenic
938798683 2:134740058-134740080 GCAAATCCATTTTCAAAAAGAGG + Intergenic
939737147 2:145861621-145861643 ACCTATCCATTTTCAAAAAGAGG - Intergenic
943926375 2:193787272-193787294 TATAGTCCATGTTCATAAATAGG + Intergenic
944177224 2:196845536-196845558 TCTTACCCATGTTCAAAAAGAGG + Intronic
948993904 2:241568883-241568905 TCCAATCCACCCTCATACAGCGG - Intronic
1169316903 20:4599788-4599810 TCCAAACCTTGTTTAAAAAGGGG - Intergenic
1171317145 20:24205354-24205376 TCCAATCAAAGCTCAGAAAGAGG - Intergenic
1171516670 20:25743829-25743851 TCCAATCTATGTTCAATGAGTGG - Intergenic
1174803248 20:53582766-53582788 GCCCATCCATGTACATTAAGAGG + Exonic
1175689610 20:61056140-61056162 TCCAATCCAATTCCATAAATCGG + Intergenic
1179245721 21:39632624-39632646 TCCAATGCATATTAATAATGAGG - Intronic
1181811833 22:25407975-25407997 TCCAATCTACATTTATAAAGAGG + Intergenic
1182761202 22:32723684-32723706 TCCGCTCTATTTTCATAAAGGGG - Intronic
1184897047 22:47415640-47415662 ACCAATCCATGTTCAAAGGGAGG - Intergenic
950586786 3:13897983-13898005 TCAAGTCCAAGTTCATACAGAGG + Intergenic
951410560 3:22359975-22359997 TCCCATTCATGTTTAAAAAGTGG - Intronic
955498239 3:59558927-59558949 TCCAATCCACTTTCAAACAGAGG + Intergenic
956592303 3:70927458-70927480 TCCAATGCATATTCATGAGGTGG - Intergenic
957703853 3:83754749-83754771 GACATTCCATGTTCATAAATTGG - Intergenic
959521436 3:107326839-107326861 TCAATTCCCTGTTCAAAAAGAGG + Intergenic
959654606 3:108787995-108788017 TCCAATCTATGAGCATGAAGTGG - Intergenic
961725703 3:128927884-128927906 GACATTCCATGTTCATAAATTGG + Intronic
964631378 3:158814253-158814275 TTAAATCCATTTTCAGAAAGTGG - Intronic
965259661 3:166465910-166465932 TGCTATTGATGTTCATAAAGAGG - Intergenic
966644122 3:182224101-182224123 ACCATTCCATGTTCATGAATAGG - Intergenic
967452277 3:189638922-189638944 CCCAATACATGCTCATAAAAAGG + Intronic
967533384 3:190574884-190574906 ACCAATCCATATTCATACACAGG + Intronic
967757250 3:193183922-193183944 TCCTATCCATGTGCATAAAATGG - Intergenic
971147111 4:23990175-23990197 TCCAATCCTTGGTTAAAAAGAGG + Intergenic
973025936 4:45271083-45271105 GACATCCCATGTTCATAAAGTGG + Intergenic
973666003 4:53159898-53159920 TCCCATCCTTTTTCATATAGTGG - Intronic
975369118 4:73563686-73563708 ACTATTCCATGTTCATAAATTGG - Intergenic
975504148 4:75119613-75119635 TCCAATCCAAAGACATAAAGTGG + Intergenic
976136391 4:81941625-81941647 GCCATTCCATGTTCATGAATAGG + Intronic
976582524 4:86754861-86754883 GCCAATCCACCTTCATATAGAGG + Intronic
977088980 4:92645857-92645879 TCCCATCAATGTTCATCAACAGG - Intronic
980848092 4:138348323-138348345 TTCAAGCCATGTTCTTAGAGAGG - Intergenic
983942505 4:173549909-173549931 TGCAACCCATAATCATAAAGTGG - Intergenic
994861209 5:105198004-105198026 TGCAATACATGTGCATAAAATGG + Intergenic
994982509 5:106893784-106893806 ATTAATCCATGATCATAAAGAGG + Intergenic
998112496 5:139512989-139513011 TGCCATCTGTGTTCATAAAGAGG - Intergenic
1001107375 5:168866369-168866391 TCCAATCCACTGTCATAATGTGG + Intronic
1005774673 6:29117927-29117949 TCTAATCCAGGATCATAAGGTGG + Intergenic
1009412830 6:63386213-63386235 TCCTATCTATATTCACAAAGGGG - Intergenic
1009445156 6:63733734-63733756 CCCAATGCATGTTTATAACGTGG - Intronic
1010490790 6:76474297-76474319 TCGAATCAATGTCCACAAAGTGG - Intergenic
1011580694 6:88860606-88860628 TCCTATCCATTTTCCAAAAGTGG + Intronic
1013114623 6:107092999-107093021 GACATTCCATGCTCATAAAGAGG + Intronic
1013425971 6:110012854-110012876 TCAACTTCATGTTGATAAAGTGG - Intergenic
1015055485 6:128897787-128897809 TGCAATCCAAGTTCATAAAGGGG - Intronic
1015656270 6:135522589-135522611 TCCAATCTATATTCCTCAAGGGG - Intergenic
1017652121 6:156593318-156593340 TCAAATCCATGTTGTTCAAGGGG - Intergenic
1020910431 7:14123056-14123078 TGCAACCCATGTACATAAATAGG + Intergenic
1021576627 7:22111279-22111301 TCCAATCCATGTCTATCTAGTGG + Intergenic
1027650254 7:80857928-80857950 TATATTCTATGTTCATAAAGTGG + Intronic
1031126224 7:117776210-117776232 TCTAATCCATGTTCATTCTGGGG + Intronic
1031181812 7:118428607-118428629 GCCAATCCATGTTCATCAATAGG - Intergenic
1032365601 7:131296532-131296554 TCAAACCCATGTTCTTCAAGGGG - Intronic
1033500153 7:141939620-141939642 TCCAATCAAAGTACATAGAGTGG + Intronic
1038029273 8:23622927-23622949 TCCAATGCTTGTGCACAAAGAGG - Intergenic
1041811845 8:61920239-61920261 TTAAATCAATCTTCATAAAGTGG - Intergenic
1045176663 8:99732414-99732436 TCCAAGGCATATCCATAAAGCGG - Intronic
1046198870 8:110895530-110895552 TCGAATCCCTGTTCATAATGAGG + Intergenic
1046335725 8:112783854-112783876 GTCAATACATGTTGATAAAGGGG + Intronic
1047660662 8:127032353-127032375 GATAATCCATGTTCATGAAGAGG + Intergenic
1048283261 8:133121047-133121069 ACCAAGCCATGTTCATGCAGAGG + Intronic
1049032528 8:140048263-140048285 TCCAATCAATTGTCATAAACAGG + Intronic
1050161631 9:2725784-2725806 TCCATTCCTTGTTCATTATGAGG + Intronic
1050406775 9:5317249-5317271 TCCAATCAAAATACATAAAGTGG + Intergenic
1052080007 9:24192958-24192980 TCCAATTCATGTTCACAACCCGG - Intergenic
1052123611 9:24749111-24749133 TTAAGTCCATGTTCATAAATAGG - Intergenic
1052305384 9:27002906-27002928 TATAATCCATGTTCATGGAGTGG - Intronic
1053146894 9:35718137-35718159 TCCAATCCAAGATCAAGAAGTGG - Intronic
1054895473 9:70305677-70305699 TCCAATACATTTTCAAAAAAAGG - Intronic
1055375276 9:75642904-75642926 TCCAAACCATAATCTTAAAGTGG + Intergenic
1055849595 9:80610266-80610288 TTCAATCCATGTCCCTAAAAAGG + Intergenic
1055852990 9:80654413-80654435 TTCAATCCATGTCCCTAAAAAGG + Intergenic
1058726417 9:107808874-107808896 TCCAACCCCTGTTCAGAAACCGG + Intergenic
1059548685 9:115205412-115205434 TCCAAACCAGGTTCATATCGTGG - Intronic
1185996824 X:4960878-4960900 CCCTTTCCTTGTTCATAAAGAGG - Intergenic
1187003424 X:15205956-15205978 TCCAAGACATGGTCATAAGGTGG - Intergenic
1187574229 X:20537511-20537533 TACAAGCCATGTTCATATAACGG - Intergenic
1189630533 X:42947868-42947890 TACAACCCATGTACATAAAATGG - Intergenic
1190547412 X:51543346-51543368 TGCATTCCATATTGATAAAGGGG - Intergenic
1191033431 X:55999457-55999479 TACAATCCATGGTCATAGATTGG - Intergenic
1192664550 X:73075137-73075159 GACAATCCATGTTCATAAGTTGG + Intergenic
1192751923 X:74001313-74001335 TCTAATCAAAGTACATAAAGTGG + Intergenic
1193740479 X:85210650-85210672 ACCATTCCATGTTCTTAAAGGGG - Intergenic
1198714397 X:139541093-139541115 TCCAATCCATGTTTAAATGGCGG + Exonic
1198724410 X:139662228-139662250 GCCAATCCATGTTCATATCTTGG + Intronic
1200306297 X:155029040-155029062 TCCCATCCAGATTCATGAAGAGG - Intronic
1201678309 Y:16613230-16613252 CCCTTTCCTTGTTCATAAAGAGG + Intergenic