ID: 1095893114

View in Genome Browser
Species Human (GRCh38)
Location 12:47253062-47253084
Sequence TGGCAGACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095893104_1095893114 24 Left 1095893104 12:47253015-47253037 CCCTGCCTGATCTGGAGGGATGG 0: 4
1: 33
2: 76
3: 174
4: 324
Right 1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG No data
1095893107_1095893114 19 Left 1095893107 12:47253020-47253042 CCTGATCTGGAGGGATGGAAGTC 0: 29
1: 69
2: 102
3: 85
4: 220
Right 1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG No data
1095893106_1095893114 23 Left 1095893106 12:47253016-47253038 CCTGCCTGATCTGGAGGGATGGA 0: 4
1: 28
2: 74
3: 166
4: 325
Right 1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095893114 Original CRISPR TGGCAGACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr