ID: 1095894554

View in Genome Browser
Species Human (GRCh38)
Location 12:47267350-47267372
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095894550_1095894554 6 Left 1095894550 12:47267321-47267343 CCATGGACACATGTGGGATCAAC No data
Right 1095894554 12:47267350-47267372 GTCCCAGAAATTGCTAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095894554 Original CRISPR GTCCCAGAAATTGCTAAGGA GGG Intergenic
No off target data available for this crispr