ID: 1095899419

View in Genome Browser
Species Human (GRCh38)
Location 12:47312451-47312473
Sequence CCGCCTTATAACCTCCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095899416_1095899419 7 Left 1095899416 12:47312421-47312443 CCTTGTATGTTTATTTGTTCATT No data
Right 1095899419 12:47312451-47312473 CCGCCTTATAACCTCCTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095899419 Original CRISPR CCGCCTTATAACCTCCTTAA GGG Intergenic
No off target data available for this crispr