ID: 1095900687

View in Genome Browser
Species Human (GRCh38)
Location 12:47325239-47325261
Sequence CCTACAACGGGGAGGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095900687_1095900708 30 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900708 12:47325292-47325314 ATTCATGAGACCCAGGGAAGGGG No data
1095900687_1095900706 28 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900706 12:47325290-47325312 TCATTCATGAGACCCAGGGAAGG No data
1095900687_1095900704 23 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900704 12:47325285-47325307 GCGGATCATTCATGAGACCCAGG No data
1095900687_1095900705 24 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900705 12:47325286-47325308 CGGATCATTCATGAGACCCAGGG No data
1095900687_1095900699 4 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900699 12:47325266-47325288 TAAGGAGCCCTAGATCCCAGCGG No data
1095900687_1095900707 29 Left 1095900687 12:47325239-47325261 CCCCACCCCCTCCCCGTTGTAGG No data
Right 1095900707 12:47325291-47325313 CATTCATGAGACCCAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095900687 Original CRISPR CCTACAACGGGGAGGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr