ID: 1095901324

View in Genome Browser
Species Human (GRCh38)
Location 12:47331597-47331619
Sequence TAAGTATGATGTTAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095901322_1095901324 13 Left 1095901322 12:47331561-47331583 CCAATCTTAGAAGGAATGCATTC No data
Right 1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG No data
1095901320_1095901324 21 Left 1095901320 12:47331553-47331575 CCTTGTTCCCAATCTTAGAAGGA No data
Right 1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG No data
1095901321_1095901324 14 Left 1095901321 12:47331560-47331582 CCCAATCTTAGAAGGAATGCATT No data
Right 1095901324 12:47331597-47331619 TAAGTATGATGTTAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095901324 Original CRISPR TAAGTATGATGTTAGCTGCA GGG Intergenic
No off target data available for this crispr