ID: 1095907328

View in Genome Browser
Species Human (GRCh38)
Location 12:47391646-47391668
Sequence AGGTGGGGAGTGGCGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095907328_1095907342 26 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907342 12:47391695-47391717 GCTTCCCAGCAAAAGCACAGGGG No data
1095907328_1095907340 24 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907340 12:47391693-47391715 GTGCTTCCCAGCAAAAGCACAGG No data
1095907328_1095907343 27 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907343 12:47391696-47391718 CTTCCCAGCAAAAGCACAGGGGG No data
1095907328_1095907334 -5 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907334 12:47391664-47391686 CACCTCACATACCCACACACTGG No data
1095907328_1095907341 25 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907341 12:47391694-47391716 TGCTTCCCAGCAAAAGCACAGGG No data
1095907328_1095907337 2 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907337 12:47391671-47391693 CATACCCACACACTGGCAGTGGG No data
1095907328_1095907336 1 Left 1095907328 12:47391646-47391668 CCTGTGGCCGCCACTCCCCACCT No data
Right 1095907336 12:47391670-47391692 ACATACCCACACACTGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095907328 Original CRISPR AGGTGGGGAGTGGCGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr