ID: 1095912052

View in Genome Browser
Species Human (GRCh38)
Location 12:47437738-47437760
Sequence CAAAGCAAACAGAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095912047_1095912052 9 Left 1095912047 12:47437706-47437728 CCCACAACATCTCAGAAGTATGC No data
Right 1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG No data
1095912046_1095912052 14 Left 1095912046 12:47437701-47437723 CCAAACCCACAACATCTCAGAAG No data
Right 1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG No data
1095912048_1095912052 8 Left 1095912048 12:47437707-47437729 CCACAACATCTCAGAAGTATGCT No data
Right 1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095912052 Original CRISPR CAAAGCAAACAGAAGGAAGG AGG Intergenic
No off target data available for this crispr