ID: 1095916473

View in Genome Browser
Species Human (GRCh38)
Location 12:47485110-47485132
Sequence TTGAATCTCCTATAGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095916473 Original CRISPR TTGAATCTCCTATAGGAGAA TGG Intergenic
902161365 1:14533094-14533116 TTGATTCTCATTTTGGAGAAAGG - Intergenic
904102105 1:28040132-28040154 TTGATTCTTCTATAGTATAATGG - Intronic
907806651 1:57827211-57827233 TTTGATGTCCTATAGGAGAAGGG - Intronic
907883479 1:58572602-58572624 CTGAAGCTCATAGAGGAGAATGG - Intergenic
909350543 1:74647948-74647970 TGGAAGCTCCTATAGGGCAAAGG + Intronic
910461536 1:87452966-87452988 TTGAAACTTTTATAGGAGAGTGG + Intergenic
911497261 1:98646984-98647006 TTGAGTCTCCTATACATGAAGGG - Intergenic
912357054 1:109062894-109062916 TTGAATCTGCTCTGGGAAAACGG + Intronic
915098634 1:153482775-153482797 TTACATCTCCAATAGGAGATTGG - Intergenic
920657600 1:207888110-207888132 TTCCAGCTCCTAGAGGAGAAAGG + Intronic
921475437 1:215601489-215601511 TTTAATCTCTTGTATGAGAAAGG + Intronic
1065770802 10:29076341-29076363 TGGAATCTACTCTAGGAAAATGG + Intergenic
1072467941 10:95684469-95684491 CTAAATCCCCTATAAGAGAAGGG + Intronic
1073566346 10:104538708-104538730 TTGAATCTCGTAGAGAAGACAGG - Intergenic
1073860472 10:107732553-107732575 TAAAATCTCCTAGAGGAGCATGG + Intergenic
1074482921 10:113843388-113843410 TTAAAACTCATATAGAAGAATGG + Intronic
1075773891 10:124966448-124966470 TTAAATGTCCTATAAGAGTAAGG - Intronic
1077746123 11:4907847-4907869 TTTAATCTCCTTAAGGTGAAGGG - Exonic
1077829887 11:5855506-5855528 TGGAATCTCCCATAAGAAAATGG + Intronic
1081263295 11:40987540-40987562 TTGAATCTAGTATCGGAGCATGG + Intronic
1086282073 11:85201159-85201181 TTGGATCTGCTATGGGACAAAGG - Intronic
1086916021 11:92531173-92531195 TTTAATGTTCTATAGGACAAGGG - Intronic
1088581717 11:111323059-111323081 TTTATTTTCCTATAGGAAAAAGG + Intergenic
1088701714 11:112419093-112419115 TTCAACCTCCTAAAGAAGAAAGG - Intergenic
1089815171 11:121166478-121166500 TTGCCTCTTCTAAAGGAGAATGG + Intronic
1091015644 11:132048924-132048946 TTGAATCTCCTACAGGGTAAGGG - Intronic
1092650185 12:10626416-10626438 TTGAAGCTCCCATGGGACAAGGG - Intronic
1093292974 12:17351687-17351709 TTGAATTTCCTATGGAAAAAAGG + Intergenic
1093955396 12:25211919-25211941 TTGTTTCTCCCACAGGAGAAAGG + Intronic
1094776561 12:33735891-33735913 TGGAATCCCCTAAATGAGAATGG - Intergenic
1095916473 12:47485110-47485132 TTGAATCTCCTATAGGAGAATGG + Intergenic
1098422937 12:70323061-70323083 TTGGTTCTCCTCAAGGAGAATGG - Intronic
1099310065 12:81008116-81008138 TTAAATCTGCTATGGCAGAAAGG - Intronic
1100711516 12:97262002-97262024 TTGAATTTCCTAAATGAGATAGG + Intergenic
1102685297 12:114719899-114719921 TTGAAACTCTTACAGGTGAAAGG - Intergenic
1104163664 12:126205412-126205434 TTCCATCACCTATAGGAGAAGGG - Intergenic
1105915076 13:24907166-24907188 TTAAAGCTGCTATTGGAGAAAGG - Exonic
1108720004 13:53121306-53121328 TTTAATCTCCTAAAGGCAAATGG + Intergenic
1110042057 13:70773934-70773956 TTGAAGCTGCTATAGGATCAGGG - Intergenic
1111284619 13:86072553-86072575 TTTAATCTCTTATAGAAAAATGG - Intergenic
1114015622 14:18426100-18426122 TTGACTCTCCTATAGGATTCCGG - Intergenic
1114769533 14:25412486-25412508 TTTATTTTCCTATAGGAGACAGG - Intergenic
1115391551 14:32860385-32860407 TTAAAACCCCTCTAGGAGAAGGG - Intergenic
1116348223 14:43823960-43823982 TTCAATCTGCTATAGGCTAATGG + Intergenic
1116627909 14:47290305-47290327 TTTAATCTCATATGGCAGAAAGG - Intronic
1117150160 14:52878621-52878643 TTCAATCTCTTCCAGGAGAATGG + Exonic
1119946027 14:78695370-78695392 TTGAATCTACAAAAAGAGAAAGG - Intronic
1120257060 14:82134033-82134055 TTGAATCTGCAAAAAGAGAAAGG - Intergenic
1120265367 14:82242097-82242119 TAGACTCTACTATAGCAGAAGGG - Intergenic
1123679766 15:22753639-22753661 TTGAATTTCCTACAGGACAAAGG + Intergenic
1124331981 15:28828115-28828137 TTGAATTTCCTACAGGACAAAGG + Intergenic
1127616077 15:60687100-60687122 TTGAATCACCTAGAGAAGAGAGG + Intronic
1128098718 15:64979901-64979923 TTGAGTCTTCTCTGGGAGAAAGG - Intronic
1128245535 15:66130148-66130170 TTGAATCTCCCAGAGGAGAATGG - Intronic
1129570775 15:76681892-76681914 TAAAATCTCCTAGAGGAGCATGG - Intronic
1133660509 16:7911839-7911861 TGGAAGCTCCCCTAGGAGAAGGG + Intergenic
1134282975 16:12834267-12834289 TTGAATCTCCTTTAATGGAAAGG + Intergenic
1139017698 16:62710104-62710126 TTTTATCTCCTATTGGAAAATGG + Intergenic
1140155282 16:72418514-72418536 TTGGATCTGCTAAGGGAGAAAGG + Intergenic
1141378046 16:83549720-83549742 TTGAATTTCCAATAAGAGAAAGG + Intronic
1148997652 17:51725274-51725296 TTGAATAACCCATATGAGAAAGG + Intronic
1150891375 17:69154060-69154082 TTTTATCTCCTTTAGTAGAAGGG - Intronic
1151173027 17:72264229-72264251 ATGAATGTCTTATAGGGGAAGGG + Intergenic
1155260854 18:24040700-24040722 TTGAGTATCCAATAGGTGAAGGG + Intronic
1156196371 18:34778195-34778217 TAGAAGCTCCTACAGGAGATGGG + Intronic
1158367557 18:56755648-56755670 TTGAAACTCCTTTAGGAGACTGG + Intronic
1165390278 19:35534677-35534699 TTGTTTCTGCTATGGGAGAAAGG - Intronic
1166510061 19:43400843-43400865 CTGATTCACCTATAGGAGGAGGG - Intergenic
926369244 2:12163672-12163694 GAGAATCTCCTACAGGAAAATGG - Intergenic
926701768 2:15808661-15808683 TGGAAGCTTCTATAGGAAAATGG + Intergenic
927990552 2:27443968-27443990 TTGAATCTCCTAAATGTAAAAGG + Exonic
929079620 2:38109481-38109503 TTGTATCTCCTTTGGCAGAAGGG + Intronic
929229391 2:39543653-39543675 TTAATTCTCCTGTAGGAGAGGGG + Intergenic
929849727 2:45574715-45574737 TTGAAAGCCCTTTAGGAGAAGGG + Exonic
930968851 2:57369070-57369092 TTGAATCACCTATAATATAAAGG + Intergenic
931808750 2:65833888-65833910 TTTAATATCCTCCAGGAGAATGG + Intergenic
934112256 2:88754965-88754987 TTGAGTTTCAAATAGGAGAATGG + Intergenic
937877510 2:126836741-126836763 TTGATTCTCCTCCAGGAGAGAGG + Intergenic
938100816 2:128497030-128497052 TTGATCCTCCTTGAGGAGAAGGG + Intergenic
938125056 2:128665249-128665271 GTAAATGTCCTATAGGAGAAAGG - Intergenic
939501438 2:142990408-142990430 TTGAATCCCCTAAAGTTGAAAGG - Intronic
941462816 2:165792132-165792154 TTGAATCTCCAAAGTGAGAAAGG + Intronic
946573724 2:221051697-221051719 ATTAATCTCCTAAGGGAGAAGGG - Intergenic
947878558 2:233484783-233484805 TTGAATCTCCTTTGTAAGAACGG + Intronic
948315151 2:237022865-237022887 TTGGATCTCCTCTGGGAGAAGGG + Intergenic
1170826514 20:19800731-19800753 ATGAATCTGCTATAGGAGCAGGG - Intergenic
1173354597 20:42275349-42275371 TTGCATCTTCTAAAGGAAAAGGG - Intronic
1175174469 20:57102622-57102644 TTGAATCTCCTTTTCCAGAAGGG - Intergenic
1177577466 21:22976779-22976801 TATTTTCTCCTATAGGAGAAGGG - Intergenic
1180440133 22:15356972-15356994 TTGACTCTCCTATAGGATTCCGG - Intergenic
1180788877 22:18562953-18562975 TTGACACTTCTAAAGGAGAAGGG + Intergenic
1181232860 22:21432367-21432389 TTGACACTTCTAAAGGAGAAGGG - Intronic
1181245791 22:21502490-21502512 TTGACACTTCTAAAGGAGAAGGG + Intergenic
1183830075 22:40413792-40413814 GTGTATCTTCTATTGGAGAATGG - Intronic
949537791 3:5009249-5009271 TCTAATTTCCTAGAGGAGAAAGG - Intergenic
951000802 3:17557265-17557287 TTTTTTCTCCCATAGGAGAAAGG - Intronic
951458261 3:22918339-22918361 ATGAATCTCCTGTTGAAGAAAGG - Intergenic
952578677 3:34805142-34805164 TTGAAGCTCCAAGAGAAGAATGG + Intergenic
953283137 3:41578187-41578209 TAGAATATTCTATTGGAGAAAGG - Intronic
954970262 3:54646020-54646042 TGGAATCTCGTATAGGTGAAGGG + Intronic
954996058 3:54882805-54882827 TTGAAGATCCTATAGAAGTATGG - Intronic
956551991 3:70471413-70471435 TTGAAAATCCTAAAAGAGAACGG + Intergenic
959160240 3:102715309-102715331 TTAAATTTCATCTAGGAGAAAGG - Intergenic
960717651 3:120593592-120593614 TTGAATCTCCAGGTGGAGAACGG + Intergenic
961227456 3:125264630-125264652 GTGAAACTAATATAGGAGAATGG - Intronic
964129586 3:153272168-153272190 TTGAATCTCATTTAGAAGGAAGG + Intergenic
964787203 3:160410150-160410172 CTGAATGTCCTATGGGAAAAGGG - Intronic
964855021 3:161137547-161137569 TTGTATCTTCCACAGGAGAAAGG + Intronic
966107790 3:176358551-176358573 TTGAATCCCTTATAGGTGATTGG + Intergenic
967763399 3:193250852-193250874 TTTAATCTCCAATTGGAAAAAGG - Intronic
968052663 3:195666108-195666130 TTGGATCTCCTGATGGAGAATGG + Intergenic
968103148 3:195982246-195982268 TTGGATCTCCTGATGGAGAATGG - Intergenic
968968917 4:3783496-3783518 TTGACACTCCTAAAGGAGAAAGG + Intergenic
969253609 4:5988086-5988108 TTGAATCTCCCATAGCAGGTGGG + Intronic
970626288 4:17887757-17887779 ATCAATCTGCTATGGGAGAATGG + Intronic
970736578 4:19177014-19177036 TAGCTTCTACTATAGGAGAATGG + Intergenic
971912979 4:32820682-32820704 TTAAAATTCTTATAGGAGAAAGG - Intergenic
971924474 4:32989678-32989700 TAGAATCTCCTTTAGGAGACTGG + Intergenic
975622656 4:76309360-76309382 TTGAATCTCCTATGGGAGAATGG + Exonic
977838594 4:101674052-101674074 TTGAATAAACTATAGGAAAAAGG + Intronic
980756179 4:137165206-137165228 TATAATCTCCTAAAGCAGAAAGG - Intergenic
981906598 4:149928243-149928265 TGGCATCTCCAATAGCAGAAAGG - Intergenic
985498913 5:228227-228249 TTGGATCTCCTGATGGAGAATGG + Exonic
986390733 5:7285434-7285456 TTGAATTTCCTACAGGACAAAGG + Intergenic
986396321 5:7334315-7334337 TTGAGTCTTCTATAGGAGGCTGG + Intergenic
986995036 5:13597203-13597225 TTGCATTTCGTATAGGAGAAGGG - Intergenic
988213559 5:28241469-28241491 TTGAATCTGCTAGGGAAGAAGGG - Intergenic
990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG + Intronic
992384136 5:76267516-76267538 TTGAATCACCTTAAGTAGAATGG - Intronic
993027717 5:82665425-82665447 GTGAATCTCCAAGAGGTGAAAGG - Intergenic
994152880 5:96469420-96469442 GTCAAATTCCTATAGGAGAAAGG - Intergenic
994579376 5:101619544-101619566 TTTTATCTACTATAGGATAAAGG - Intergenic
995402703 5:111759688-111759710 TTGAGTCTCCTCTAGGTGAAGGG + Intronic
997187890 5:131900597-131900619 TAAAATCTCCTAGAGGAGGAAGG - Intronic
1000290913 5:159870484-159870506 TTGAATCTCCCATAGGCCAGTGG - Intergenic
1002806162 6:576229-576251 TTGTATCTCAAATAGGAAAATGG + Intronic
1003036535 6:2644994-2645016 TTGCATCTCTTTTAGCAGAAAGG - Intergenic
1007191107 6:40019612-40019634 TTGAAACTACTAGAGGAAAACGG + Intergenic
1011083208 6:83511852-83511874 TTTATTCTCCTTTAGGAGAGGGG - Intergenic
1013567960 6:111388142-111388164 TTAAAGCTACTTTAGGAGAAGGG - Intronic
1014372141 6:120623530-120623552 TTGAATGTCCAATATGAAAATGG - Intergenic
1018641044 6:165904288-165904310 TTGCATCTGCCTTAGGAGAAGGG + Intronic
1019169540 6:170124756-170124778 ATGAATATCCTATTGGATAAGGG + Intergenic
1021712235 7:23427307-23427329 TTGAGTTTCCTATAGGGAAACGG - Intronic
1023516615 7:41008227-41008249 TGGAAACTCCTAGAGGAAAATGG - Intergenic
1028014629 7:85691570-85691592 TTGCATCAGCTATAAGAGAAAGG - Intergenic
1028720872 7:94029741-94029763 TGGAATCTATTATAAGAGAATGG - Intergenic
1029702539 7:102256984-102257006 TTGAACCACCTATAGGGGAAAGG - Exonic
1030144458 7:106339432-106339454 TTCACTCTTCTATAAGAGAAGGG + Intergenic
1031713678 7:125080305-125080327 TTGAATTTCCTGGAGTAGAAGGG - Intergenic
1035844346 8:2847193-2847215 TTGATTTTCCTATTGAAGAACGG - Intergenic
1036095359 8:5718280-5718302 TTGAAACCCCTATAGGAAATAGG + Intergenic
1036604130 8:10291628-10291650 TTGAATCTCGTGTGGGAAAAGGG + Intronic
1041835407 8:62207663-62207685 TTCAATCTCCTAATGGTGAATGG + Intergenic
1042420457 8:68582370-68582392 TATAATCTACTATAGGACAAGGG + Intronic
1042475090 8:69238844-69238866 GTGAACCTCCTAAAGTAGAATGG - Intergenic
1043793489 8:84504605-84504627 TTTTATCTCTTATAGGAAAAAGG + Intronic
1046126768 8:109919983-109920005 TAGAATCTCCTATGTGATAATGG + Intergenic
1046597073 8:116273247-116273269 TTAAATCTCCTAGAGGAGCATGG + Intergenic
1049116185 8:140689909-140689931 TTGACTCTACTGTAGCAGAAAGG + Intronic
1050694644 9:8265055-8265077 TTGACTGCCCTCTAGGAGAAGGG - Intergenic
1050802732 9:9636423-9636445 TTGAATCTGTCATTGGAGAAAGG - Intronic
1054992206 9:71341580-71341602 TTGAATGCTCAATAGGAGAAGGG + Intronic
1055504048 9:76930312-76930334 CTGAATCTCCTAGTGGGGAATGG + Intergenic
1055610576 9:78020180-78020202 TTGCATCTCCTATAGTAAAATGG - Intronic
1058123130 9:101161068-101161090 TTGTATCTCTTATAGGTCAAGGG - Intronic
1059724063 9:116988767-116988789 TTTAAGCTCCTATAGAAGTATGG - Intronic
1203684010 Un_KI270757v1:23148-23170 TTGAATCTGCAATAGGAAATTGG + Intergenic
1186364034 X:8873076-8873098 TTCATTCTCTTATAGAAGAAAGG - Intergenic
1190469796 X:50767263-50767285 TTAAATCTCCAATAATAGAATGG + Intronic
1192844862 X:74896046-74896068 TTGAATCTGCTATGGAAAAAGGG - Intronic
1196106641 X:111903597-111903619 CTGCATCTCCTCCAGGAGAATGG + Intronic
1196393090 X:115230341-115230363 TTGAATCTCCAATTGGTGATTGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic