ID: 1095917671

View in Genome Browser
Species Human (GRCh38)
Location 12:47496480-47496502
Sequence TACAGTCATCAATTTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095917671_1095917672 -2 Left 1095917671 12:47496480-47496502 CCAACTTTAAATTGATGACTGTA No data
Right 1095917672 12:47496501-47496523 TAGCATGCTGTACTCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095917671 Original CRISPR TACAGTCATCAATTTAAAGT TGG (reversed) Intergenic
No off target data available for this crispr