ID: 1095919672

View in Genome Browser
Species Human (GRCh38)
Location 12:47516768-47516790
Sequence GAGATGGGCTACGACAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095919663_1095919672 21 Left 1095919663 12:47516724-47516746 CCTCCTTTGACTCCATGTCTCAC 0: 53
1: 92
2: 59
3: 71
4: 300
Right 1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG No data
1095919662_1095919672 30 Left 1095919662 12:47516715-47516737 CCAAAATGACCTCCTTTGACTCC 0: 72
1: 1336
2: 1850
3: 1523
4: 1038
Right 1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG No data
1095919664_1095919672 18 Left 1095919664 12:47516727-47516749 CCTTTGACTCCATGTCTCACATC 0: 1251
1: 1968
2: 1560
3: 958
4: 671
Right 1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG No data
1095919668_1095919672 9 Left 1095919668 12:47516736-47516758 CCATGTCTCACATCCAGGGGACA No data
Right 1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG No data
1095919669_1095919672 -4 Left 1095919669 12:47516749-47516771 CCAGGGGACATTGATGCAAGAGA No data
Right 1095919672 12:47516768-47516790 GAGATGGGCTACGACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095919672 Original CRISPR GAGATGGGCTACGACAGCCT TGG Intergenic
No off target data available for this crispr