ID: 1095919930

View in Genome Browser
Species Human (GRCh38)
Location 12:47518740-47518762
Sequence CCTTCCCAGGGAGCCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095919920_1095919930 13 Left 1095919920 12:47518704-47518726 CCTCAATCACCCACCCCTGTGCT No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919922_1095919930 4 Left 1095919922 12:47518713-47518735 CCCACCCCTGTGCTGGCTGTGTC No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919919_1095919930 14 Left 1095919919 12:47518703-47518725 CCCTCAATCACCCACCCCTGTGC No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919926_1095919930 -2 Left 1095919926 12:47518719-47518741 CCTGTGCTGGCTGTGTCAGATCC No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919924_1095919930 0 Left 1095919924 12:47518717-47518739 CCCCTGTGCTGGCTGTGTCAGAT No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919918_1095919930 18 Left 1095919918 12:47518699-47518721 CCATCCCTCAATCACCCACCCCT No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919925_1095919930 -1 Left 1095919925 12:47518718-47518740 CCCTGTGCTGGCTGTGTCAGATC No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data
1095919923_1095919930 3 Left 1095919923 12:47518714-47518736 CCACCCCTGTGCTGGCTGTGTCA No data
Right 1095919930 12:47518740-47518762 CCTTCCCAGGGAGCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095919930 Original CRISPR CCTTCCCAGGGAGCCTCACC TGG Intergenic