ID: 1095921845

View in Genome Browser
Species Human (GRCh38)
Location 12:47539649-47539671
Sequence GAGCTCAGCATATCTAAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095921845_1095921846 -8 Left 1095921845 12:47539649-47539671 CCGATTTTAGATATGCTGAGCTC No data
Right 1095921846 12:47539664-47539686 CTGAGCTCTCAATGCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095921845 Original CRISPR GAGCTCAGCATATCTAAAAT CGG (reversed) Intergenic
No off target data available for this crispr