ID: 1095922589

View in Genome Browser
Species Human (GRCh38)
Location 12:47545655-47545677
Sequence TGTAAGTGACATATCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095922589_1095922593 -7 Left 1095922589 12:47545655-47545677 CCCTCCAAGATATGTCACTTACA No data
Right 1095922593 12:47545671-47545693 ACTTACATCTGCTAGGTATATGG No data
1095922589_1095922594 -4 Left 1095922589 12:47545655-47545677 CCCTCCAAGATATGTCACTTACA No data
Right 1095922594 12:47545674-47545696 TACATCTGCTAGGTATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095922589 Original CRISPR TGTAAGTGACATATCTTGGA GGG (reversed) Intergenic
No off target data available for this crispr