ID: 1095923026

View in Genome Browser
Species Human (GRCh38)
Location 12:47550058-47550080
Sequence CCTCCACCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923026_1095923031 3 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG No data
Right 1095923031 12:47550084-47550106 GAGGATCACTTGAGCCCAGGAGG No data
1095923026_1095923030 0 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG No data
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG No data
1095923026_1095923032 9 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG No data
Right 1095923032 12:47550090-47550112 CACTTGAGCCCAGGAGGTCAAGG No data
1095923026_1095923035 30 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG No data
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923026 Original CRISPR CCTCCACCTCCCAAGTAGCT GGG (reversed) Intergenic