ID: 1095923026

View in Genome Browser
Species Human (GRCh38)
Location 12:47550058-47550080
Sequence CCTCCACCTCCCAAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586690
Summary {0: 189, 1: 3368, 2: 103445, 3: 215442, 4: 264246}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923026_1095923030 0 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG 0: 189
1: 3368
2: 103445
3: 215442
4: 264246
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG 0: 761
1: 10322
2: 31536
3: 65887
4: 114148
1095923026_1095923035 30 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG 0: 189
1: 3368
2: 103445
3: 215442
4: 264246
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data
1095923026_1095923031 3 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG 0: 189
1: 3368
2: 103445
3: 215442
4: 264246
Right 1095923031 12:47550084-47550106 GAGGATCACTTGAGCCCAGGAGG 0: 4056
1: 12008
2: 45036
3: 94118
4: 144639
1095923026_1095923032 9 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG 0: 189
1: 3368
2: 103445
3: 215442
4: 264246
Right 1095923032 12:47550090-47550112 CACTTGAGCCCAGGAGGTCAAGG 0: 1194
1: 5546
2: 15541
3: 38106
4: 81285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923026 Original CRISPR CCTCCACCTCCCAAGTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr