ID: 1095923028

View in Genome Browser
Species Human (GRCh38)
Location 12:47550059-47550081
Sequence ACCTCCACCTCCCAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376187
Summary {0: 56, 1: 838, 2: 17253, 3: 121387, 4: 236653}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923028_1095923032 8 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923032 12:47550090-47550112 CACTTGAGCCCAGGAGGTCAAGG 0: 1194
1: 5546
2: 15541
3: 38106
4: 81285
1095923028_1095923031 2 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923031 12:47550084-47550106 GAGGATCACTTGAGCCCAGGAGG 0: 4056
1: 12008
2: 45036
3: 94118
4: 144639
1095923028_1095923035 29 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data
1095923028_1095923036 30 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923036 12:47550112-47550134 GCTGCACTGCATTCCATCCTGGG No data
1095923028_1095923030 -1 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG 0: 761
1: 10322
2: 31536
3: 65887
4: 114148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923028 Original CRISPR ACCTCCACCTCCCAAGTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr