ID: 1095923030

View in Genome Browser
Species Human (GRCh38)
Location 12:47550081-47550103
Sequence TGAGAGGATCACTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923026_1095923030 0 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG No data
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG No data
1095923028_1095923030 -1 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT No data
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG No data
1095923021_1095923030 27 Left 1095923021 12:47550031-47550053 CCAGGCATAGTGACATGTGACTG No data
Right 1095923030 12:47550081-47550103 TGAGAGGATCACTTGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923030 Original CRISPR TGAGAGGATCACTTGAGCCC AGG Intergenic