ID: 1095923033

View in Genome Browser
Species Human (GRCh38)
Location 12:47550098-47550120
Sequence CAGTGCAGCCTTGACCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121366
Summary {0: 33, 1: 3626, 2: 14230, 3: 30454, 4: 73023}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923033_1095923036 -9 Left 1095923033 12:47550098-47550120 CCCAGGAGGTCAAGGCTGCACTG 0: 33
1: 3626
2: 14230
3: 30454
4: 73023
Right 1095923036 12:47550112-47550134 GCTGCACTGCATTCCATCCTGGG No data
1095923033_1095923035 -10 Left 1095923033 12:47550098-47550120 CCCAGGAGGTCAAGGCTGCACTG 0: 33
1: 3626
2: 14230
3: 30454
4: 73023
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923033 Original CRISPR CAGTGCAGCCTTGACCTCCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr