ID: 1095923035

View in Genome Browser
Species Human (GRCh38)
Location 12:47550111-47550133
Sequence GGCTGCACTGCATTCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095923028_1095923035 29 Left 1095923028 12:47550059-47550081 CCAGCTACTTGGGAGGTGGAGGT 0: 56
1: 838
2: 17253
3: 121387
4: 236653
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data
1095923033_1095923035 -10 Left 1095923033 12:47550098-47550120 CCCAGGAGGTCAAGGCTGCACTG 0: 33
1: 3626
2: 14230
3: 30454
4: 73023
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data
1095923026_1095923035 30 Left 1095923026 12:47550058-47550080 CCCAGCTACTTGGGAGGTGGAGG 0: 189
1: 3368
2: 103445
3: 215442
4: 264246
Right 1095923035 12:47550111-47550133 GGCTGCACTGCATTCCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095923035 Original CRISPR GGCTGCACTGCATTCCATCC TGG Intergenic
No off target data available for this crispr