ID: 1095925456

View in Genome Browser
Species Human (GRCh38)
Location 12:47575094-47575116
Sequence CAGTCATATTTTGAAGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095925452_1095925456 23 Left 1095925452 12:47575048-47575070 CCTCATTCTAACTTAATTACCTC No data
Right 1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG No data
1095925454_1095925456 4 Left 1095925454 12:47575067-47575089 CCTCTCTAAAGGCTCTATCTCCA No data
Right 1095925456 12:47575094-47575116 CAGTCATATTTTGAAGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095925456 Original CRISPR CAGTCATATTTTGAAGTGCT TGG Intergenic
No off target data available for this crispr