ID: 1095928587

View in Genome Browser
Species Human (GRCh38)
Location 12:47604169-47604191
Sequence CTGGTTTACCAGCACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095928587_1095928594 -2 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928594 12:47604190-47604212 AGCTTACTGTGTGGAGGGAGGGG No data
1095928587_1095928593 -3 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928593 12:47604189-47604211 CAGCTTACTGTGTGGAGGGAGGG No data
1095928587_1095928595 -1 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928595 12:47604191-47604213 GCTTACTGTGTGGAGGGAGGGGG No data
1095928587_1095928596 0 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928596 12:47604192-47604214 CTTACTGTGTGGAGGGAGGGGGG No data
1095928587_1095928597 7 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928597 12:47604199-47604221 TGTGGAGGGAGGGGGGAAAAAGG No data
1095928587_1095928589 -8 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928589 12:47604184-47604206 TAAACCAGCTTACTGTGTGGAGG No data
1095928587_1095928590 -7 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928590 12:47604185-47604207 AAACCAGCTTACTGTGTGGAGGG No data
1095928587_1095928592 -4 Left 1095928587 12:47604169-47604191 CCAGTGGTGTGCTGGTAAACCAG No data
Right 1095928592 12:47604188-47604210 CCAGCTTACTGTGTGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095928587 Original CRISPR CTGGTTTACCAGCACACCAC TGG (reversed) Intergenic
No off target data available for this crispr