ID: 1095928787

View in Genome Browser
Species Human (GRCh38)
Location 12:47605738-47605760
Sequence CCCCAGCAGGGACTCCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095928779_1095928787 6 Left 1095928779 12:47605709-47605731 CCCTTTTCTCGCAGCTCCACTAG No data
Right 1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG No data
1095928780_1095928787 5 Left 1095928780 12:47605710-47605732 CCTTTTCTCGCAGCTCCACTAGG No data
Right 1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG No data
1095928782_1095928787 -10 Left 1095928782 12:47605725-47605747 CCACTAGGCAGTGCCCCAGCAGG 0: 25
1: 427
2: 1294
3: 1723
4: 1749
Right 1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095928787 Original CRISPR CCCCAGCAGGGACTCCATGT GGG Intergenic
No off target data available for this crispr