ID: 1095931619

View in Genome Browser
Species Human (GRCh38)
Location 12:47631995-47632017
Sequence CTCTCCAGGGCCTCTTTAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095931611_1095931619 14 Left 1095931611 12:47631958-47631980 CCTTCTTGCTGCTTCTTCATATG No data
Right 1095931619 12:47631995-47632017 CTCTCCAGGGCCTCTTTAAGGGG No data
1095931610_1095931619 28 Left 1095931610 12:47631944-47631966 CCTCATAGATAGTGCCTTCTTGC No data
Right 1095931619 12:47631995-47632017 CTCTCCAGGGCCTCTTTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095931619 Original CRISPR CTCTCCAGGGCCTCTTTAAG GGG Intergenic
No off target data available for this crispr