ID: 1095934781

View in Genome Browser
Species Human (GRCh38)
Location 12:47666052-47666074
Sequence CCTCCTGTACTAAACATACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095934781_1095934783 -10 Left 1095934781 12:47666052-47666074 CCATGTATGTTTAGTACAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 153
Right 1095934783 12:47666065-47666087 GTACAGGAGGTATCTGAAAATGG 0: 1
1: 0
2: 3
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095934781 Original CRISPR CCTCCTGTACTAAACATACA TGG (reversed) Intronic
900981664 1:6049341-6049363 CCTCCTGGACTCAACCTTCAGGG + Intronic
901383786 1:8893165-8893187 CCGTCTCTACTAAAAATACACGG + Intergenic
904119459 1:28187651-28187673 CCACCTTTACAAAAAATACACGG - Intronic
907037197 1:51226939-51226961 CCATCTCTACTAAAAATACAAGG + Intergenic
909217467 1:72908722-72908744 GCTCCTGTACTAAACATGTACGG + Intergenic
910199399 1:84683101-84683123 TCTCCTGTACTAAAGATAGTAGG - Intronic
911292724 1:96077560-96077582 CCATCTCTACTAAAAATACAAGG - Intergenic
914729939 1:150361352-150361374 CCATCTCTACTAAAAATACAGGG - Intergenic
919699718 1:200619650-200619672 ATTCCTGTATTCAACATACATGG - Intronic
919941597 1:202290700-202290722 CCATCTCTACTAAAAATACAAGG + Intronic
920392396 1:205616619-205616641 CCTTCTGTACTGAACAGTCATGG - Exonic
920442603 1:205990941-205990963 CCGCCTCTACTAAAAATACGTGG - Intronic
920544031 1:206800803-206800825 CCTCCCGGACTTAACACACACGG - Intronic
921269294 1:213452877-213452899 TGTCCTGTACAAATCATACAAGG - Intergenic
921886117 1:220308142-220308164 CCATCTCTACTAAAAATACAAGG - Intergenic
922266175 1:223986101-223986123 CCGTCTCTACTAAAAATACAAGG + Intergenic
1062769850 10:90948-90970 CCATCTGTACCAAAAATACAAGG + Intergenic
1064087704 10:12357722-12357744 CCTCCTGCACTAAATAAGCACGG - Intronic
1069745850 10:70714524-70714546 CCTCCAGTACTGAACATAAGAGG - Intronic
1070121220 10:73579119-73579141 CCATCTGTACTAAAAATACATGG - Intronic
1070241258 10:74683645-74683667 CCTCCTGTTCTAGACGCACATGG + Intronic
1070493766 10:77001934-77001956 CCTCCTGTATTAATCATATCAGG - Intronic
1073318231 10:102597775-102597797 CCTCCTGTCATATAGATACAGGG + Intronic
1076985696 11:234585-234607 CCGTCTTTACTAAAAATACAAGG - Intronic
1078618154 11:12883839-12883861 CCGTCTCTACTAAAAATACATGG + Intronic
1079012889 11:16844164-16844186 CCTGCTGTACAAAAAATTCATGG + Intronic
1081465252 11:43310211-43310233 CCACTTGTACAGAACATACACGG - Intergenic
1085897114 11:80653501-80653523 CTTCCTGGACTAAACCAACATGG - Intergenic
1086799192 11:91150506-91150528 CCATCTCTACTAAAAATACAAGG - Intergenic
1090243433 11:125199671-125199693 CCATCTCTACTAAAAATACAAGG + Intronic
1092918267 12:13207712-13207734 CCTCATCTACCTAACATACATGG - Intronic
1095934781 12:47666052-47666074 CCTCCTGTACTAAACATACATGG - Intronic
1097370424 12:58772128-58772150 ACTCCTGTACTTAAAATAAAAGG + Intronic
1101402048 12:104396985-104397007 CCTCCTGGTCTAAAACTACAGGG - Intergenic
1103344787 12:120242002-120242024 CCTCCTGCAGGAAACAAACATGG - Intronic
1103414252 12:120733269-120733291 CCGTCTCTACTAAAAATACAAGG - Intronic
1104938277 12:132379008-132379030 CCGTCTCTACTAAAAATACATGG + Intergenic
1109628629 13:65013548-65013570 CCATCTGTACTAAAAATACAAGG - Intergenic
1111552606 13:89834595-89834617 TCTCCTGTTCTATACACACATGG + Intergenic
1113017787 13:105847626-105847648 CTTCCTGTTCTAAAAATATAAGG - Intergenic
1114838510 14:26233623-26233645 CCTCCTGTAATAATGATAGATGG + Intergenic
1115495138 14:33996536-33996558 ACTCCTGTACCAAACATTTATGG - Intronic
1118451349 14:65905329-65905351 CCTCCTGTGCTAAACCACCAGGG - Intergenic
1120760109 14:88277191-88277213 CCTCCTATACAAAACTTAAATGG + Intronic
1120983003 14:90307701-90307723 CCATCTCTACTAAAAATACAGGG + Intronic
1121110482 14:91309431-91309453 CCCTCTATACAAAACATACAAGG + Intronic
1128204533 15:65839006-65839028 CCATCTCTACTAAAAATACAAGG - Intronic
1128760151 15:70210970-70210992 CCTCATGCACAAAACTTACAAGG + Intergenic
1128999910 15:72323389-72323411 GCTTCTCTACTAAAAATACAAGG - Intronic
1130103180 15:80909345-80909367 CCTCCAGTGCTAACCATCCATGG - Intronic
1133241792 16:4418492-4418514 CCGTCTCTACTAAAAATACAAGG + Intronic
1135003043 16:18793331-18793353 CTTCCTGGACTAAACCAACATGG - Exonic
1139656981 16:68394620-68394642 CCTGCTGCACTAAACTTAGAAGG - Intronic
1140549091 16:75844590-75844612 CCTCTTGTACCAGACATCCAAGG - Intergenic
1144292149 17:13837221-13837243 CCGTCTCTACTAAAAATACAAGG - Intergenic
1144867432 17:18345545-18345567 CCGTCTCTACTAAAAATACATGG - Intronic
1146050926 17:29552891-29552913 CCATCTCTACTAAAAATACATGG + Intergenic
1146070183 17:29673397-29673419 CCATCTCTACTAAAAATACAAGG + Intronic
1147192294 17:38745040-38745062 CCATCTCTACTAAAAATACATGG + Intronic
1147345832 17:39794250-39794272 CCTCATGCACTAGACATATAAGG + Intronic
1147932637 17:43992408-43992430 CCGTCTCTACTAAAAATACAAGG + Intronic
1148192313 17:45688138-45688160 GCTGCTGTCCTAAACTTACAGGG + Intergenic
1148554761 17:48571724-48571746 GCTCCTGGACTAAAAATATATGG - Intronic
1154054486 18:10999929-10999951 CTTCATGTACTTAACCTACAAGG - Intronic
1157393409 18:47322027-47322049 CTTCCTGTAAGAACCATACAAGG + Intergenic
1158540524 18:58349384-58349406 CTTCCTGTACAAAACAGAGATGG + Intronic
1159482851 18:69013066-69013088 AGTGCTGTAATAAACATACAGGG - Intronic
1160319927 18:77880697-77880719 ACTCCAGTACCAAATATACAAGG + Intergenic
1160552092 18:79700307-79700329 CCTCTTGCACTAAACAGCCAAGG + Intronic
1164109611 19:22143815-22143837 CCCCCAGTAATAAACATTCATGG + Intergenic
1164194581 19:22944988-22945010 CCCCCAGTAATAAACATTCATGG + Intergenic
1164554937 19:29244230-29244252 CCTCCTGTCCTAAACATCCCGGG + Intergenic
1164631907 19:29767587-29767609 CCTCCCGTACTCACCAGACATGG + Intergenic
1165886353 19:39081828-39081850 CCGTCTCTACTAAAAATACAAGG + Intergenic
1167893084 19:52558244-52558266 CCGCCTCTACTAAAAATACAAGG - Intronic
929586429 2:43117914-43117936 TCTCCTGTGCTAAATATCCAAGG + Intergenic
932029602 2:68170251-68170273 TCTGCTGTATTAAACATACCTGG - Intronic
932778939 2:74548165-74548187 CCTCCTCTGCTGAACAGACATGG - Intronic
939823122 2:146981303-146981325 CCGTCTCTACTAAAAATACAAGG + Intergenic
942480572 2:176384003-176384025 ACTTCTGTACTAAACATCCTAGG - Intergenic
943309503 2:186309113-186309135 CCTCAATTACTAAACATAAAAGG - Intergenic
944718400 2:202398446-202398468 CCTCCTTCATTAAGCATACATGG - Intronic
947908597 2:233785733-233785755 CCACCTGTCCTAATCACACAGGG - Intronic
948734039 2:239987366-239987388 CCTCCTGGACTAGACACGCAGGG - Intronic
1168952637 20:1812826-1812848 CCATCTCTACTAAAAATACAAGG + Intergenic
1169842212 20:9951892-9951914 CCATCTCTACTAAAAATACAAGG + Intergenic
1169994344 20:11540327-11540349 CCTGCTTTATTACACATACAAGG + Intergenic
1170177758 20:13491455-13491477 ACTCGTGTACTCAAGATACAGGG - Intronic
1170450331 20:16476917-16476939 CCATCTCTACTAAAAATACATGG - Intronic
1170634848 20:18095281-18095303 CTGTCTGTACTAAAAATACAAGG + Intergenic
1173995275 20:47333428-47333450 CCGTCTCTACTAAAAATACATGG + Intronic
1174427731 20:50444695-50444717 CCGTCTCTACTAAAAATACACGG + Intergenic
1175127183 20:56761127-56761149 CCTCATGTTCTAAACTTAGATGG - Intergenic
1177546323 21:22562919-22562941 CCGTCTCTACTAAAAATACAAGG - Intergenic
1184958404 22:47908988-47909010 CCATCTCTACTAAAAATACAAGG - Intergenic
950075283 3:10182579-10182601 CCATCTCTACTAAAAATACAAGG - Intronic
951118926 3:18900168-18900190 CCATCTCTACTAAAAATACAAGG + Intergenic
951638264 3:24804491-24804513 CTTCCTGTGCTAAAAATAAATGG - Intergenic
956717139 3:72088447-72088469 CTGCCTCTACTAAAGATACAAGG + Intergenic
960760239 3:121065185-121065207 ACTGCTGTACTAAACATATGAGG + Intronic
961539863 3:127591942-127591964 GCTCCTGTCCTAAAAACACAGGG + Intronic
966788440 3:183641320-183641342 CCGTCTCTACTAAAAATACATGG + Intronic
969122739 4:4921862-4921884 CCGTCTCTACTAAAAATACATGG - Intergenic
969938247 4:10704704-10704726 CCCCCTGTGCTCAACATACTAGG + Intergenic
970557837 4:17253575-17253597 CCATCTCTACTAAAAATACAAGG + Intergenic
973093221 4:46164389-46164411 CCGTCTCTACTAAAAATACAAGG - Intergenic
973536756 4:51890712-51890734 CCTCCTGTCCTAATCAGGCATGG + Intronic
974043278 4:56876313-56876335 CCATCTCTACTAAATATACAAGG + Intergenic
976844586 4:89473548-89473570 CTTCCTGTACTCCACATTCAAGG + Intergenic
980939009 4:139254964-139254986 CCGTCTCTACTAAAAATACAAGG - Intergenic
982244573 4:153338132-153338154 CTTCCACTACTAAATATACAGGG + Exonic
987821904 5:22975405-22975427 CCTCTTGACCTAAACATAAAGGG - Intergenic
987941788 5:24548288-24548310 CCATCTCTACTAAAAATACATGG - Intronic
988524533 5:31975555-31975577 CCTCCTCTACTCAGCATAAATGG - Intronic
988699702 5:33661102-33661124 CCTCCTTTACTATACATACCTGG + Intronic
990662731 5:58035910-58035932 CCTCGTGTCCTAAACACCCAAGG + Intergenic
991911370 5:71565157-71565179 CTTCCTGTGCTAAGCACACATGG + Exonic
993521900 5:88913099-88913121 CCTCCTTTTATAACCATACAAGG + Intergenic
993640920 5:90404318-90404340 TATACTGTACTAAACATACCTGG + Intronic
998526216 5:142845599-142845621 CTTCCTTTTCTAAAAATACACGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1001433964 5:171685331-171685353 CTTCCTGAACTACACATAGAGGG - Intergenic
1003005144 6:2374269-2374291 TCTCCTGTACTAAGAAAACATGG - Intergenic
1003463988 6:6359919-6359941 ACTTTTTTACTAAACATACAAGG - Intergenic
1005009103 6:21319034-21319056 GCTACTGTATTAAGCATACAGGG + Intergenic
1005761782 6:28974137-28974159 CCATCTCTACTAAAAATACATGG - Intergenic
1008672510 6:53785826-53785848 CCATCTCTACTAAAAATACATGG - Intergenic
1009242156 6:61196561-61196583 CCATCTCTACTAAAAATACAAGG - Intergenic
1011140033 6:84142804-84142826 CCTGCTGTGCTTAATATACATGG - Intronic
1011247909 6:85339281-85339303 CAACCTGTACTAAACCTTCAGGG + Intergenic
1018018432 6:159733741-159733763 CCGTCTCTACTAAAAATACAAGG + Intronic
1019986713 7:4662042-4662064 GTGGCTGTACTAAACATACACGG - Intergenic
1020072416 7:5235881-5235903 CCGTCTCTACTAAAAATACATGG + Intergenic
1020182309 7:5931826-5931848 CCCCATCTACTAAAAATACAAGG + Intronic
1020300601 7:6792931-6792953 CCCCATCTACTAAAAATACAAGG - Intronic
1022331715 7:29385532-29385554 CCTCCTGTCCTTAGCATACCAGG - Intronic
1022459032 7:30586677-30586699 CCGTCTCTACTAAAAATACATGG + Intergenic
1026143418 7:67725336-67725358 CCTCCTGTCCTAAAGATATGAGG - Intergenic
1027170840 7:75871177-75871199 CCGTCTCTACTAAAAATACATGG + Intronic
1031551460 7:123118952-123118974 CCTCCTGTAAGTAACTTACAGGG - Intronic
1032079640 7:128852484-128852506 CCCCCTGGACTCAACAGACACGG - Intronic
1034519122 7:151605185-151605207 CCGTCTCTACTAAAAATACAAGG - Intronic
1034741184 7:153474954-153474976 GCTCCTGTACTTAGCACACATGG - Intergenic
1040481030 8:47826930-47826952 CATACTTTACTAAACATAAAAGG + Intronic
1044602769 8:94022202-94022224 CCGTCTCTACTAAAAATACAAGG + Intergenic
1044617028 8:94152835-94152857 CCTTCTCTACTAAAAATAAAAGG - Intronic
1047485109 8:125322886-125322908 CCATCTCTACTAAAAATACAAGG + Intronic
1048490433 8:134886961-134886983 CCTCCTCTATTAAACACAGAGGG - Intergenic
1052273629 9:26653734-26653756 CCTCTTGTTCTAGACATACTTGG + Intergenic
1055486106 9:76758358-76758380 CCTCCTGGACTGAAAATACTAGG - Intronic
1059100297 9:111465011-111465033 CCGTCTCTACTAAAAATACAAGG + Intronic
1060395028 9:123310179-123310201 CCATCTCTACTAAAAATACAAGG - Intergenic
1062125748 9:134861160-134861182 CCATCTCTACTAAAAATACATGG + Intergenic
1185578564 X:1192982-1193004 CCATCTCTACTAAAAATACAAGG - Intronic
1187128784 X:16480848-16480870 ACTCTTGTATTAAACATTCAAGG - Intergenic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190389746 X:49920330-49920352 CCATCTCTACTAAAAATACATGG - Intergenic
1190885161 X:54525205-54525227 CCGTCTCTACTAAAAATACACGG + Intergenic
1196908728 X:120464911-120464933 CCATCTCTACTAAAAATACAAGG - Intronic
1201788334 Y:17809219-17809241 CTTCCTGTTCTGAAGATACATGG - Intergenic
1201813219 Y:18096769-18096791 CTTCCTGTTCTGAAGATACATGG + Intergenic