ID: 1095935987

View in Genome Browser
Species Human (GRCh38)
Location 12:47681967-47681989
Sequence TTTTTATTCTCACCAAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095935987 Original CRISPR TTTTTATTCTCACCAAATCC TGG Intronic
900360517 1:2286602-2286624 ATTTTATTCTTACCACATCAGGG + Intronic
900731853 1:4267348-4267370 TTTTTTTTTTCACTAATTCCGGG + Intergenic
904305738 1:29587765-29587787 TGTTTATTCTCACAGATTCCTGG - Intergenic
904872887 1:33632603-33632625 GTTTTATTCTCACAAAAACCAGG - Intronic
905022531 1:34827756-34827778 TTTTTATTTTCACCATGTGCTGG + Intronic
905051886 1:35058757-35058779 TTTTAATTCTCAGCAAGTCAAGG - Intergenic
908152225 1:61313682-61313704 TTTTTTTTCTCACCAAATGATGG - Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
908896667 1:68909046-68909068 TTTTCATTCTTACCATATCCTGG + Intergenic
909253286 1:73385275-73385297 TATTTATTTTCATCCAATCCAGG + Intergenic
909326216 1:74353629-74353651 TTTTTTTGATCACCAAATCAAGG - Intronic
909646793 1:77925961-77925983 GTTTTTTTCTCACTAAATACTGG + Intronic
911413855 1:97545907-97545929 TCTTTAAACTCACCAAATCCTGG - Intronic
911632440 1:100198614-100198636 ATTTGATTCTCACAAAATTCTGG - Intronic
912377536 1:109223453-109223475 TTTTCCTTGTCACCAAATGCTGG + Intronic
913333866 1:117690403-117690425 TTTTTATTATCACCATGTGCCGG - Intergenic
914503694 1:148270026-148270048 TTTTTATTACCACTTAATCCTGG + Intergenic
915636095 1:157187982-157188004 TTTTTATTCCCACCAATGTCTGG + Intergenic
916489195 1:165286547-165286569 ATTTTATTTTTACCAAATCAGGG - Intronic
918063749 1:181085504-181085526 TATGTATTTTCACCATATCCTGG + Intergenic
918176132 1:182046954-182046976 TTCTTATTGTGACCACATCCTGG + Intergenic
921211736 1:212906608-212906630 TCTTTATTCTCTCCATATTCTGG - Intergenic
921668190 1:217897627-217897649 TTTTTAGTCTCACAAAATGATGG - Intergenic
923627536 1:235626522-235626544 TTTAAATTCTCACCTAATTCTGG + Intronic
924353269 1:243140505-243140527 GTTTTTTCCTCCCCAAATCCAGG + Intronic
1063333404 10:5185171-5185193 TCTTTATTTGCACCAAATGCAGG + Intergenic
1063988909 10:11538112-11538134 TTTTTTCTCACACCAAGTCCTGG + Intronic
1065421948 10:25554820-25554842 TTTTTATAATCACCATATACTGG - Intronic
1065648944 10:27866982-27867004 TTTTTTTTCTCAAGAAAACCGGG + Intronic
1066028654 10:31393629-31393651 TTTTTAATGTCACGAAAACCAGG - Intronic
1066251931 10:33641795-33641817 TCTTTATTATAACCAAATACTGG + Intergenic
1066753890 10:38689917-38689939 TATTTATTCCCACAAAATCTAGG - Intergenic
1067131098 10:43566174-43566196 TTTCTATTTTCAGCTAATCCTGG - Intronic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1068414896 10:56707895-56707917 TTTTTATCATCACCAATTCATGG + Intergenic
1068794448 10:61063118-61063140 TTGTCATTGCCACCAAATCCTGG - Intergenic
1069344633 10:67453736-67453758 TATTTATTCACAACAAAGCCTGG - Intronic
1069796998 10:71059987-71060009 TTTTTAATGACCCCAAATCCTGG - Intergenic
1070463913 10:76699176-76699198 TTTTTATTATCACCAGGTACTGG + Intergenic
1070712288 10:78691531-78691553 TTGATATTGTCAACAAATCCAGG + Intergenic
1071251979 10:83828001-83828023 TTTTTTTTCTCCCCAGCTCCTGG + Intergenic
1071302788 10:84269209-84269231 TATTTATTCTCCCCCAAGCCTGG - Intergenic
1071843436 10:89497325-89497347 TATTTATTCTCAAAAAATACAGG + Intronic
1071930030 10:90458632-90458654 TCTTTATTGTCCCCAAAGCCTGG - Intergenic
1072675979 10:97466491-97466513 TTTAAATTCTCACCAACTCTGGG + Exonic
1072822827 10:98574999-98575021 TTTTTATTTTTACCATTTCCTGG + Intronic
1073131793 10:101194041-101194063 TTTTTCTTTTGACCAGATCCAGG - Intergenic
1073437552 10:103529129-103529151 TTTTTATTAAAACCAAATCATGG + Intronic
1074777464 10:116776513-116776535 TTTTTTTTCTTAACAAAACCCGG + Intergenic
1076198753 10:128540830-128540852 TTTTCATTTTAACCAAATCAGGG + Intergenic
1077817937 11:5706290-5706312 TATTTATTCCCACCATATCCAGG + Intronic
1078397539 11:10994509-10994531 TTTTTAAACTCAGCAAGTCCTGG + Intergenic
1078931668 11:15917059-15917081 TTTATATTCTCACCAACACATGG + Intergenic
1079194465 11:18313613-18313635 TTTTTATTTTTAAGAAATCCAGG + Intronic
1079197877 11:18346119-18346141 TTTTTAGCCTCACCAATTCCTGG + Intronic
1079897382 11:26138410-26138432 TTTTTATACCCAGCAAATCCTGG + Intergenic
1080894734 11:36439742-36439764 TTTTTGTTCTCAGCTGATCCAGG + Intronic
1081301419 11:41457183-41457205 TTCATATTCTCACCAAATACTGG - Intronic
1085590941 11:77759820-77759842 ATTTAATTCTCACCACAACCTGG - Intronic
1086454132 11:86944880-86944902 TTTTTACTCACACCAAAACAGGG + Intronic
1086529414 11:87766384-87766406 TTTTTATTATCACTAGATACTGG - Intergenic
1087399371 11:97645235-97645257 TTTTTACTGTTACCAATTCCTGG + Intergenic
1087963847 11:104387920-104387942 TGTTTGTTCTCACCTATTCCAGG - Intergenic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088395000 11:109357404-109357426 TTTTTATTCCCCCCAAATTCAGG + Intergenic
1089030145 11:115317816-115317838 TTATTTTTCTCAGCCAATCCAGG + Intronic
1089167101 11:116485693-116485715 CTTTTCTTCCCACCCAATCCAGG - Intergenic
1090389672 11:126380887-126380909 TTTTTACTCAGACCATATCCAGG + Intronic
1094826693 12:34275076-34275098 CTTTTGTTCTCACAGAATCCTGG - Intergenic
1095273534 12:40251443-40251465 TCTTTTTTCTCCCCTAATCCAGG + Exonic
1095547972 12:43394892-43394914 TTTTTATTCCCCACAAATGCAGG - Intronic
1095935987 12:47681967-47681989 TTTTTATTCTCACCAAATCCTGG + Intronic
1096379828 12:51147032-51147054 TTTATATGCACAGCAAATCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097560759 12:61203544-61203566 TGTTTATTCTCAACAATTCGTGG + Intergenic
1098226169 12:68327501-68327523 TTTTAATTCTCAGGAAATCAAGG - Intronic
1098599450 12:72313046-72313068 TTTATATTCTAACCAAATAAAGG - Intronic
1098723871 12:73937793-73937815 TTTTTATTACCACATAATCCTGG - Intergenic
1098947992 12:76609372-76609394 TTTTTTTTCTTTCCAGATCCAGG + Intergenic
1099075046 12:78096333-78096355 TGTTTGTTCTCACCAGCTCCTGG + Intronic
1099537952 12:83868228-83868250 TTTTTATTCTGATTAAAACCTGG + Intergenic
1100576868 12:95899964-95899986 GTTTAATTCTCACCACATCAGGG - Intronic
1104217002 12:126743322-126743344 TTTGTCTTCTCCCCAAATCCAGG - Intergenic
1106066436 13:26356234-26356256 TTTTTATTGTCACTATATGCTGG + Intronic
1107558687 13:41541410-41541432 TTTTTATTATCACTATATGCTGG + Intergenic
1108007137 13:45960485-45960507 TTTTTATGGTGACCAAATCTAGG - Intronic
1108468026 13:50738403-50738425 TTTTTATTATCACCATGTACTGG - Intronic
1108560524 13:51639062-51639084 TTTTTATTGTCACAAAATCAAGG + Intronic
1108747051 13:53406620-53406642 TTATTATTATCACCAATTTCTGG + Intergenic
1109088077 13:58001762-58001784 TTTTTATTTTAACCCTATCCAGG + Intergenic
1109330178 13:60919192-60919214 TTTTAATTCTCCACAAAGCCAGG + Intergenic
1109341070 13:61059770-61059792 TTTTTATTCTCACCATGCACAGG - Intergenic
1110012282 13:70352364-70352386 TTATTATTCACACCAAATTTAGG + Intergenic
1110158599 13:72348787-72348809 TTTTTAATCTCACAAAATTCTGG + Intergenic
1110805869 13:79753560-79753582 GATTTATGCCCACCAAATCCAGG - Intergenic
1113407307 13:110053454-110053476 GCTTTATTCTCACCAAATTTTGG + Intergenic
1115073863 14:29362065-29362087 TTTTTTTTTTCACCAAAGGCAGG - Intergenic
1115312171 14:31990147-31990169 TTTTTATTTTCACTTCATCCTGG + Intergenic
1116253885 14:42524551-42524573 TTATTATTCTAACCAATTACTGG - Intergenic
1116285378 14:42964622-42964644 TTTTTTTCTTCTCCAAATCCTGG - Intergenic
1116368232 14:44096622-44096644 TTTTTCTACTCACCAATTTCTGG + Intergenic
1117764822 14:59070850-59070872 TATTTATTCTCATCAAATGAAGG + Intergenic
1118179883 14:63481862-63481884 TTTTTATTCTGACAAAATTCTGG + Intronic
1118380010 14:65209782-65209804 TTTTTATTTTCACCACATGCTGG + Intergenic
1119021214 14:71117329-71117351 TTTTTATTATCACTGAATCTTGG + Intergenic
1120386877 14:83857657-83857679 TTTTTATTGTAACCAACACCTGG + Intergenic
1120550762 14:85869577-85869599 TTTCTCTACTCCCCAAATCCTGG - Intergenic
1120580579 14:86243032-86243054 TATTTATTATCACCAAACACTGG + Intergenic
1121377451 14:93426367-93426389 TTTTTTTTGTCACCAAATTTTGG + Intronic
1121700391 14:95949409-95949431 TTTTTATTATCACCATGTGCTGG - Intergenic
1126191090 15:45879615-45879637 TTTTTTTTCCCCCCAACTCCAGG + Intergenic
1126807153 15:52362455-52362477 TTTTTATTCTCTGCAATTCTGGG + Intronic
1127908604 15:63396494-63396516 TGTTTATTCTGGCCAAAACCTGG + Intergenic
1129380103 15:75159195-75159217 CTTTTATTCTCACCATGTGCTGG + Intergenic
1130243702 15:82222710-82222732 TCTTTGTTCTCAACAAATGCTGG - Intronic
1130456773 15:84118565-84118587 TCTTTATTCTCAACAAATACTGG + Intergenic
1132085577 15:98905856-98905878 TCTTAATTCTCACCTAATCATGG + Intronic
1132710900 16:1266793-1266815 ATTTTATTCTCTCTCAATCCTGG - Intergenic
1133009570 16:2903553-2903575 TTTTTATTTTCAGAAAATCAAGG + Intergenic
1134401369 16:13913472-13913494 ATTTTATTCTCTGCAAATACAGG - Intergenic
1135240666 16:20804821-20804843 TATTTATTATTCCCAAATCCTGG - Intronic
1135429094 16:22366993-22367015 TGTTCATTATCACCAAATCCAGG - Intronic
1135894900 16:26390613-26390635 TTTTTATTCTGACAAAATCCAGG - Intergenic
1136728854 16:32387268-32387290 TATTTATTCCCACAAAATCTAGG + Intergenic
1138794828 16:59955003-59955025 TTTTGATGCTCTCCAGATCCAGG + Intergenic
1139205079 16:65020982-65021004 TTTTTTTTTTTACCAAATCCTGG + Intronic
1140799823 16:78476091-78476113 TTCTAATTGTTACCAAATCCAGG + Intronic
1140975912 16:80060040-80060062 TTTTGAGTTTCTCCAAATCCTGG - Intergenic
1202997550 16_KI270728v1_random:130235-130257 TATTTATTCCCACAAAATCTAGG - Intergenic
1203024237 16_KI270728v1_random:442577-442599 TATTTATTCCCACAAAATCTAGG - Intergenic
1144264620 17:13556189-13556211 TTCTAATTCTCCCCAAATCTAGG - Intronic
1145029332 17:19492741-19492763 TTTTTATTATCCCAAAATTCAGG - Intergenic
1147336416 17:39729199-39729221 TATTTATTCTCCCCTAACCCAGG - Exonic
1149098983 17:52881675-52881697 TTTTTATTCTCAAGACTTCCAGG + Intronic
1149398457 17:56269590-56269612 CTTTTTTTCTCATGAAATCCAGG - Intronic
1151085967 17:71380988-71381010 TTTATTTTCTCACTAAATCAAGG + Intergenic
1151149772 17:72075055-72075077 TCTTTATTCTCAAGAAATGCAGG + Intergenic
1152297375 17:79475916-79475938 TCTTCGTTCTCACCAATTCCTGG - Intronic
1155846810 18:30718438-30718460 TTTTTATTCTCACTTAATTAGGG + Intergenic
1155873383 18:31054550-31054572 TTTTTATTCTTACCCAAATCGGG - Intergenic
1156005789 18:32439324-32439346 CTTTTATTGTCACCTAATTCTGG - Intronic
1156658938 18:39322638-39322660 TCTTTAGTCTCACAAATTCCTGG - Intergenic
1157002063 18:43538744-43538766 ATTTTATTTTTACCAAATACAGG - Intergenic
1158387234 18:57008592-57008614 TTGTTCTTCTCACCAACTTCTGG + Intronic
1159236754 18:65684624-65684646 TCTTCATTGTCACAAAATCCTGG - Intergenic
1159253281 18:65909700-65909722 TCTTTATTATCACAAATTCCAGG - Intergenic
1159296922 18:66503173-66503195 TTATTATTCTATCCAAATCAAGG - Exonic
1159611082 18:70526352-70526374 TTTTTATTCTGGCCAAATATAGG - Intergenic
1159696489 18:71563336-71563358 TTTTTATTTCCCCCAAATCGTGG - Intergenic
1164888276 19:31801982-31802004 TTTTTAATCTGTTCAAATCCTGG + Intergenic
1166438580 19:42790327-42790349 TTTTTTTTTTCACCAAATTGTGG + Intronic
1167801487 19:51745785-51745807 TGTTTATTCTCCCCAAATCAGGG + Exonic
1168379192 19:55905925-55905947 CTTTGATTCTCCCCAAATCCAGG - Intronic
925106426 2:1296219-1296241 TCATTATTCTAACCAATTCCAGG - Intronic
925486352 2:4336290-4336312 CTTTGATTCTCACTACATCCCGG - Intergenic
925794116 2:7524527-7524549 TTTTCTCTCTCCCCAAATCCAGG + Intergenic
925819849 2:7789529-7789551 GTTGTATTCTCTCCAAAGCCAGG - Intergenic
926510970 2:13777352-13777374 TTTGAATACTCACCAAATCCAGG - Intergenic
926856863 2:17266192-17266214 TCTTTATACTCACCAAAACCAGG - Intergenic
926946087 2:18188932-18188954 TTTTTATATTCACAAAACCCAGG + Intronic
927628839 2:24752882-24752904 TTTTTTTTTTCTCCAAATCCTGG + Intronic
928720518 2:34115673-34115695 TTTTTTTTCTTAACAATTCCTGG + Intergenic
929073896 2:38061421-38061443 TTTTTATGGTCACAAAATCAGGG - Intronic
929245177 2:39694119-39694141 TTTTTTATCTGAACAAATCCAGG - Intronic
929972194 2:46591592-46591614 TGTTTATTATCACAAAATACTGG + Intronic
930730112 2:54720839-54720861 TTTTATTTCTCACAAAAACCTGG - Intergenic
930890447 2:56379728-56379750 TTTTCTTTTTCAACAAATCCAGG + Intronic
931027744 2:58132483-58132505 TTTTTATGCTAGCCGAATCCAGG - Intronic
931794099 2:65693023-65693045 AGTTTATTCTCTCCAAATCCTGG - Intergenic
931842498 2:66169141-66169163 TCTAAGTTCTCACCAAATCCAGG + Intergenic
934185131 2:89665164-89665186 TATTTATTCCCACAAAATCTAGG + Intergenic
934317179 2:91934148-91934170 TATTTATTCCCACAAAATCTAGG - Intergenic
936289274 2:111207374-111207396 ATTTTATTCCTACCCAATCCAGG + Intergenic
936916743 2:117647554-117647576 CTTTTCTTCCCACCAACTCCAGG - Intergenic
937052774 2:118905894-118905916 TTCTTAATCTCACCAACTCCAGG - Intergenic
937819711 2:126295888-126295910 TATTTATAATCACCAAAACCTGG + Intergenic
938993776 2:136656266-136656288 CTTTAATTCTCACCAAAACTGGG - Intergenic
939504855 2:143032504-143032526 TTTTTATAGTTATCAAATCCAGG - Intronic
939782347 2:146464888-146464910 CTTCTATTCTCATCCAATCCTGG + Intergenic
939988969 2:148859465-148859487 TTTTTATTCTCACCAATCCATGG - Intergenic
940049681 2:149449042-149449064 TTTTTAGCCACACCATATCCTGG + Exonic
941223976 2:162821815-162821837 TCTTGGTTCTCACTAAATCCTGG + Intronic
941520765 2:166539255-166539277 TTCTTATTTTCACCAAATCAGGG + Intergenic
942832571 2:180254109-180254131 TTTTTACTCTCAGCAATGCCTGG + Intergenic
943416015 2:187604970-187604992 TCTATATTCTCACCAATTCTTGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944424282 2:199563294-199563316 TTTTTGTTCTCCCCAGACCCTGG + Intergenic
944856216 2:203769829-203769851 TTTTTTTTCCCACCATAACCAGG + Intergenic
945437975 2:209841281-209841303 TTTCTAATCTCACTAAAACCAGG + Intronic
945967782 2:216207465-216207487 TTTTTTTTCCCGCCAAGTCCAGG + Intergenic
946264801 2:218530142-218530164 TTTTCCTTCTCATCAAATACAGG + Intronic
946687443 2:222284818-222284840 ATTTCATTCTCACAGAATCCTGG + Intronic
1169447469 20:5684459-5684481 TTTTTATTGCCAGCAAAGCCAGG - Intergenic
1169637454 20:7708059-7708081 TTTTTATTCCCACCATAGCATGG + Intergenic
1170036159 20:11992458-11992480 ATGTTTTTCTCACCACATCCTGG - Intergenic
1171248107 20:23629465-23629487 TATTTATTTTACCCAAATCCAGG - Exonic
1171258189 20:23707590-23707612 TTTTTATCCTGACCAAGTCTGGG + Intergenic
1171350633 20:24499994-24500016 TTTCACTTCTCACTAAATCCGGG - Intronic
1171888789 20:30687458-30687480 TTTTCTTTTTCTCCAAATCCAGG + Intergenic
1173970986 20:47152166-47152188 ATTTTCTTCTCCTCAAATCCTGG + Intronic
1174940858 20:54925261-54925283 TTGTCATTCTCATCATATCCAGG + Intergenic
1174947481 20:55004076-55004098 TTTTTATTCTTTCCACATCTGGG - Intergenic
1174984681 20:55437526-55437548 TTTTTATTCTCTCCATAACATGG - Intergenic
1175733584 20:61370487-61370509 TCATTATTCCCACCAAGTCCAGG + Intronic
1177300150 21:19233690-19233712 ACTTTATTCTCACCAAAAACTGG - Intergenic
1178004719 21:28205197-28205219 TTTTTATTCTAAGCAAATGATGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178263343 21:31120103-31120125 TATTTATTCTCAATAAATCAGGG - Exonic
1178866282 21:36330189-36330211 TTTTTTTTCTTTCCAGATCCAGG + Intronic
1179120715 21:38543191-38543213 ATATTATGCTCTCCAAATCCTGG + Intronic
1180543629 22:16477717-16477739 TATTTATTCCCACAAAATCTAGG - Intergenic
1180988092 22:19917409-19917431 GTTTTGTGCTCACTAAATCCAGG - Intronic
1182236651 22:28882173-28882195 TTTTTAGTTTCTCCAAAACCGGG - Intergenic
1182321200 22:29479537-29479559 TTGCTATTCTCCCCAACTCCAGG + Intergenic
1184949403 22:47829618-47829640 CTTTTAGTCTCAGCAGATCCTGG + Intergenic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
949528706 3:4932303-4932325 TTTTTTTTCTCACCAAGACCAGG - Intergenic
950845861 3:16015543-16015565 TTTTAATTCTCAGCAAGGCCAGG + Intergenic
950846937 3:16023789-16023811 TTTTAATTCTCAGCAAGGCCAGG + Intergenic
951597166 3:24330757-24330779 TATTTTTTCCCACCAAATGCTGG - Intronic
951699320 3:25478856-25478878 TTTTTATTTTTACCAAATGTGGG + Intronic
951745005 3:25968449-25968471 TTATTCTTCACACCAAACCCAGG - Intergenic
952387480 3:32852910-32852932 TTTTTATTCACACCAAACTGGGG - Intronic
953984255 3:47429209-47429231 CTTTTCTTTTCCCCAAATCCTGG + Intronic
955322270 3:57982841-57982863 TATTTATAGTCACCAGATCCTGG + Intergenic
956696323 3:71922134-71922156 TTTTTAAACTCCCCATATCCTGG - Intergenic
957189767 3:76992539-76992561 TTTTTTTTCTCACGAAATTACGG - Intronic
957189887 3:76994049-76994071 TTTTTTTTCTCACCAAATTACGG - Intronic
959551176 3:107659798-107659820 TTTCTAGTCTCACTAAACCCAGG - Intronic
960507365 3:118510132-118510154 TTTTAATTATAACCAAAACCAGG + Intergenic
960586284 3:119323504-119323526 TTTTTTTTTTAACCACATCCAGG + Intronic
961217817 3:125174805-125174827 TTTTAATGCTCCCCAACTCCTGG - Intronic
962029711 3:131586989-131587011 TTATTAATGTCACCAAATCATGG + Intronic
964637584 3:158874184-158874206 TTTTGATTCTCCACAAAGCCTGG - Intergenic
966308842 3:178570764-178570786 TTTTTATTCTCACAAAAATGGGG + Intronic
967668282 3:192200891-192200913 TTTTTTTTCACACAAAAGCCTGG - Intronic
967823553 3:193860607-193860629 TCTCTATACTCACCAAAACCTGG - Intergenic
970303361 4:14704484-14704506 TTTTTATTCTCCAAATATCCTGG + Intergenic
970961492 4:21876968-21876990 TTTTTTTTTTCTCCTAATCCAGG - Intronic
971570282 4:28203628-28203650 ATTTTATTCTCATGAAATCATGG + Intergenic
972588653 4:40462726-40462748 TTTTGATTCCCACCAAATCTCGG - Intronic
973867724 4:55130571-55130593 TCCTTATTTTCACCAAATCAAGG - Intergenic
974632309 4:64509416-64509438 TTTTTTTTGCCACCAAATACTGG + Intergenic
974731317 4:65870010-65870032 CTTTAATTCTTACAAAATCCAGG - Intergenic
974822068 4:67080123-67080145 TTTTTTTTTTCAACAAATCCAGG + Intergenic
974921303 4:68243289-68243311 TTTTTGTTCTCATCTCATCCAGG + Intronic
975349854 4:73333133-73333155 TTATTAATGTCACCAAAACCAGG + Intergenic
975442843 4:74432910-74432932 TTTATAATCTCACCGAATGCAGG + Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
977002929 4:91526080-91526102 TTTTTCTTCTTTCCAAATCCAGG + Intronic
977377029 4:96218665-96218687 TTTATACTCACACCAAATTCAGG + Intergenic
977949172 4:102950277-102950299 TATTTATTCCCACAAAATCTAGG - Intronic
978035124 4:103983773-103983795 TTTTCATTCTCATGAATTCCAGG - Intergenic
978314463 4:107419971-107419993 TTTTTATTCTCAGCAAGGCAAGG - Intergenic
978492628 4:109324919-109324941 TTTTTAATCCCAACAATTCCTGG - Intergenic
979248668 4:118539794-118539816 GTTTTTTCCTCCCCAAATCCAGG - Intergenic
979980338 4:127247390-127247412 CTTTTCTTTTCTCCAAATCCTGG + Intergenic
980203279 4:129683969-129683991 TTTATATTATCACCAACTCTAGG - Intergenic
980569173 4:134588235-134588257 TTTTTTTTCCCAACAAATACAGG - Intergenic
980866250 4:138556656-138556678 TTTTCATTCACCCCAAATCCAGG - Intergenic
981330258 4:143500024-143500046 ATTTTTCTCTCACCAAAACCTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG + Intergenic
983761502 4:171413089-171413111 CTTTTATTATCACCATATCATGG + Intergenic
983868801 4:172800881-172800903 TTTGTATTTTCTCCAAATCGGGG - Intronic
984228154 4:177060847-177060869 AATTTATTTTCACCAAATCATGG - Intergenic
984515319 4:180731663-180731685 TTTGTGTTCTCAGCAAAACCGGG - Intergenic
985095507 4:186408864-186408886 TTTCTGTTCTCTCCATATCCTGG - Intergenic
985181909 4:187273697-187273719 ATTCTATTCACACCAAATCCTGG - Intergenic
986115307 5:4768128-4768150 TTTTTCTTCTCACCATCACCTGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987581304 5:19796182-19796204 TTTTGATTTTCACCAAATCTGGG - Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987807954 5:22794608-22794630 TTTCTATTCTCTCTAAATCTTGG - Intronic
988427705 5:31082778-31082800 TATTAATGCTCACCAAATACTGG + Intergenic
989331945 5:40270035-40270057 TTTTTTTTCTGACCAAATGTAGG - Intergenic
990047571 5:51452858-51452880 TTTTTATTCCTACATAATCCAGG + Intergenic
992167084 5:74064196-74064218 TTTTTATTATCAACATATGCTGG + Intergenic
992458297 5:76937040-76937062 ATCTTATGCTCAGCAAATCCCGG + Intergenic
992969917 5:82045904-82045926 TTTTCAATCTCACCATATCCAGG + Intronic
993092990 5:83450050-83450072 TTTGTAATCTCATCAAATACTGG + Intergenic
993168974 5:84391959-84391981 TTTTTTTTCTGAGCAAATGCTGG - Intergenic
993304575 5:86259481-86259503 TAATTAATCTCAACAAATCCTGG - Intergenic
993508264 5:88738071-88738093 TTTTTTTTGTCCCCAACTCCTGG - Intronic
994429270 5:99635528-99635550 TTTTTATTATTACCAAAACTGGG - Intergenic
994640667 5:102405291-102405313 TTTATATTTTCACCAAATTTGGG - Intronic
995167258 5:109058909-109058931 TTTTTAGTTTCACCAAAAACAGG + Intronic
998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG + Intronic
999339891 5:150761367-150761389 TTTTTATTTTCACCAAGGCAGGG - Intergenic
999613184 5:153393397-153393419 TTTTTACACTAACCAAAACCAGG + Intergenic
1000787483 5:165563819-165563841 TTTTTATTATCCCAAAATCAGGG - Intergenic
1001670745 5:173471676-173471698 TGTTTCTTCACACCAAATCATGG + Intergenic
1002059981 5:176620382-176620404 TTTTTTTTTTAACCAAAACCAGG - Exonic
1002207064 5:177570249-177570271 TTTTTATCATCACCAAGTGCTGG + Intergenic
1003456639 6:6289064-6289086 TTTTTATTCTCACAATAAACTGG - Intronic
1004179304 6:13367171-13367193 TTCTTATTCTGTCCAAATACAGG - Intronic
1004478902 6:16000304-16000326 TTTTTATGCTCACTTAACCCAGG - Intergenic
1004504467 6:16237150-16237172 CTTTAATTCTCACAAAAACCAGG + Intergenic
1004681738 6:17902404-17902426 CTTATTTTCTCTCCAAATCCTGG - Intronic
1004735015 6:18396983-18397005 GTTTTTTTCTCAGCAAATGCCGG - Intronic
1005334586 6:24781555-24781577 TTTTTATTTTCACTAGATTCTGG - Exonic
1005573435 6:27169453-27169475 TTGTTCTTTTCCCCAAATCCTGG + Intergenic
1007420040 6:41713717-41713739 TTTCTATTCTCCCCAGAGCCAGG + Intronic
1008726606 6:54429143-54429165 TTTTTATTATCCCAAAATTCTGG - Intergenic
1009404461 6:63294400-63294422 TTTTTATTGTAACCATATGCTGG + Intronic
1011114932 6:83879325-83879347 TTTGTATTCACACCGAATCTGGG + Intronic
1013201533 6:107901478-107901500 CTTTTAAACTCACCAAATCCTGG + Exonic
1013879746 6:114882484-114882506 CTTTGATTTTCCCCAAATCCTGG - Intergenic
1014522070 6:122456625-122456647 TTCTCATTCTCACAAAATCCAGG + Exonic
1014595748 6:123335909-123335931 TTTTGATTTTCACAAAATCAAGG + Intronic
1015830644 6:137365349-137365371 TTCCTATTCTGACAAAATCCTGG - Intergenic
1019811645 7:3169324-3169346 TTTTTATACTCACAGATTCCAGG - Intronic
1019860524 7:3654221-3654243 TTGTTGTTCTCACCACATCCAGG + Intronic
1020433512 7:8137466-8137488 ATTTTATTCTTACCAAAGTCAGG - Intronic
1020469436 7:8518925-8518947 TTTTTTTTCTCCCCAAAGGCTGG + Intronic
1020755632 7:12199396-12199418 TTATTATTCTAGCCAAATTCTGG + Intergenic
1021467268 7:20959041-20959063 TTTTTATTCCCACCAAACTTGGG + Intergenic
1023989960 7:45122851-45122873 TTTTTATTCTCCTCAACTCTAGG - Intergenic
1026302167 7:69107467-69107489 TTTCTATTCCCACCACATTCAGG - Intergenic
1026558724 7:71430150-71430172 TTTTTTTTGTCAAGAAATCCTGG - Intronic
1027353834 7:77337843-77337865 TTTTTCTTCTCATAAAATCAAGG + Intronic
1027879039 7:83809092-83809114 TTTTTTTTCTCCCCAACTCTGGG - Intergenic
1028446011 7:90925047-90925069 TTTTTATTTTTACCACATACCGG + Intronic
1029627901 7:101731847-101731869 TTTTTATTATCACCTTGTCCTGG - Intergenic
1030173772 7:106630425-106630447 TGTTTATACCCACCAAATTCTGG - Intergenic
1030975025 7:116111185-116111207 TTGTTATTCTGAGCAAAGCCAGG + Intronic
1030978612 7:116158536-116158558 TTTTTATTTTCTCAAAATTCTGG + Intronic
1031042906 7:116857357-116857379 ATTTTATCATCACTAAATCCTGG - Intronic
1032365516 7:131295390-131295412 TTTTTATTCTTACCATATAAAGG - Intronic
1032423143 7:131799333-131799355 TTTTTTTTCTCCCCAGATTCTGG + Intergenic
1033244668 7:139707881-139707903 TTTCTATTCCCACCCAGTCCAGG + Intronic
1033807155 7:144967628-144967650 TTTTAAAGATCACCAAATCCAGG - Intergenic
1033815886 7:145072338-145072360 TTTTTTTTCTCATCAAGTCTTGG + Intergenic
1034996566 7:155581044-155581066 TTTTTATCCTCACCAGCTCCTGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036952674 8:13156485-13156507 TTTTCCTTCCCACCAAAGCCTGG + Intronic
1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG + Intergenic
1038868089 8:31461529-31461551 TATGTGTGCTCACCAAATCCAGG - Intergenic
1038995681 8:32920514-32920536 TTTTTTTTCTTACTAAATCCAGG + Intergenic
1039762421 8:40591709-40591731 TTATTCTTCTCATCAAACCCTGG + Intronic
1043537100 8:81217861-81217883 TTTTTAAGCTCATCAAATCTGGG - Intergenic
1043829932 8:84975719-84975741 TTTGTGTTGCCACCAAATCCTGG - Intergenic
1044371612 8:91418787-91418809 CTCTTATTCTCACAAAAACCGGG - Intergenic
1044564151 8:93645599-93645621 TTTTTCTTCTCACCAGGGCCAGG - Intergenic
1044760909 8:95516473-95516495 TTTTTATTATCACCATGTGCTGG - Intergenic
1044838695 8:96319557-96319579 TTTATATTTTCACCAAAAACGGG + Intronic
1045428516 8:102091272-102091294 TTTTTACTAGCAACAAATCCTGG - Intronic
1047493034 8:125389956-125389978 TTTTTTTTACCACCATATCCTGG - Intergenic
1047641024 8:126821613-126821635 ATTTTGTTCTCACTGAATCCAGG + Intergenic
1048787386 8:138064302-138064324 AACTTATTCTCACGAAATCCAGG - Intergenic
1048910924 8:139134268-139134290 TGTATATACTGACCAAATCCAGG + Intergenic
1049328274 8:142035301-142035323 ATTTTCTCCTCACCAAAACCTGG - Intergenic
1050275038 9:3987750-3987772 TTTTTTTTTTTGCCAAATCCAGG - Intronic
1050818125 9:9840896-9840918 TTTTTATATTCAGCAGATCCTGG + Intronic
1055325177 9:75121168-75121190 ATTTAATTCTCACTAAAACCTGG - Intronic
1055882381 9:81016219-81016241 TATTTATACTCACCAAAAACTGG + Intergenic
1056188231 9:84158258-84158280 TTTTTATTATTACCATATGCTGG + Intergenic
1058660322 9:107260621-107260643 TTGTTGTTCTCACCAAATAAAGG - Intergenic
1059939232 9:119341550-119341572 TGTTTATTCTCATAAAATCGTGG - Intronic
1060037265 9:120266211-120266233 CTTTAATCCTCACCAAATCTAGG + Intergenic
1060911461 9:127354468-127354490 TTTTTATTTTCAGTAAAACCTGG - Intronic
1061027463 9:128059364-128059386 TTTTTATTGTTACTAAATACTGG + Intergenic
1061088451 9:128412599-128412621 TTGTAGTTCTGACCAAATCCAGG - Intronic
1061191936 9:129087251-129087273 GTTTCATTCACCCCAAATCCTGG + Intronic
1061284904 9:129616654-129616676 ATTTGATACTCACCAAACCCAGG - Intronic
1186140936 X:6572795-6572817 TTTTTTTTCCCAGCAAACCCAGG - Intergenic
1187080132 X:15977257-15977279 TTTTTTTTTTCACCAGTTCCCGG + Intergenic
1188147563 X:26632197-26632219 CTTTTATTCTCTCCAGCTCCAGG - Intergenic
1188810316 X:34646217-34646239 TTTTTATTTTCAACAAATAATGG + Intronic
1188984879 X:36760288-36760310 TGTTTATTCCAACCAAAACCTGG - Intergenic
1189611004 X:42735077-42735099 TATTCATTCTCACCAAATCTTGG - Intergenic
1189636435 X:43015391-43015413 TTTTTCTTCTCTCCAAATTTGGG - Intergenic
1189990442 X:46589007-46589029 TTTTCATTCTCCCCAGATTCTGG + Intronic
1191109824 X:56795740-56795762 TTTTAATTGTCAACAAATGCAGG + Intergenic
1192038097 X:67587804-67587826 TTTTCATTCTCACAAAAATCAGG - Intronic
1193406186 X:81105566-81105588 CTTTTATTCTAGCCCAATCCTGG + Intergenic
1194767896 X:97863853-97863875 TTTCTATTATAAGCAAATCCTGG + Intergenic
1196623202 X:117847841-117847863 TTTTTCTTATCTGCAAATCCAGG - Intergenic
1196666776 X:118325528-118325550 TTAATATTTTTACCAAATCCAGG + Intergenic
1197086184 X:122478506-122478528 ATTTTATCCTCATAAAATCCAGG - Intergenic
1197428980 X:126335654-126335676 TTTTTTTTCTCACAAAATGTGGG + Intergenic
1197748289 X:129947681-129947703 TTCTCATTCTCACCAACACCAGG + Intergenic
1198008592 X:132525843-132525865 ATTAAATTGTCACCAAATCCTGG - Intergenic
1199555546 X:149104281-149104303 TATTTATAATCACCAAAACCTGG - Intergenic
1201184495 Y:11386537-11386559 TATTTATTCCCACAAAATCTAGG - Intergenic